Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 27P
A DNA synthesizer is a machine that uses automated chemical synthesis to generate short, single strands of DNA of any given sequence. You have used the machine to synthesize the following three DNA molecules:
(DNA 1) | 5′ CTACTACGGATCGGG 3′ |
(DNA 2) | 5′ CCAGTCCCGATCCGT 3′ |
(DNA 3) | 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3 |
Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs.
a. | DNA 1 plus DNA 3 |
b. | DNA 2 plus DNA 3 |
c. | DNA 1 plus DNA 2 |
d. | DNA 3 only |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The metabolic pathway below is used for the production of the purine nucleotides adenosine monophosphate (AMP) and guanosine monophosphate (GMP) in eukaryotic cells. Assume each arrow represents a reaction catalyzed by a different enzyme. Using the principles of feedback inhibition, propose a regulatory scheme for this pathway that ensures an adequate supply of both AMP and GMP, and prevents the buildup of Intermediates A through G when supplies of both AMP and GMP are adequate.
QUESTION 27
Label the structures marked A, B, C and explain the role of structure A.
W
plasma membrane
For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).
BIUS
☐
Paragraph
Π " ΩΘΗ
Β
Open Sans, a...
10pt
EE
examples of synamptomorphy
Chapter 6 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 6 - For each of the terms in the left column, choose...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig. 6.15...Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a bidirectional replication fork and label...Ch. 6 - As Fig. 6.21 on p. 190 shows, DNA polymerase...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Diagram replication occurring at the end of a...Ch. 6 - Figure 6.18 on p. 187 depicts Watson and Cricks...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele the...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- examples of synamtomorphy.arrow_forwardE. Bar Graph Use the same technique to upload the completed image. We will use a different type of graph to derive additional information from the CO2 data (Fig A1.6.2) 1. Calculate the average rate of increase in COz concentration per year for the time intervals 1959-1969, 1969- 1979, etc. and write the results in the spaces provided. The value for 1959-1969 is provided for you as an example. 2. Plot the results as a bar graph. The 1959-1969 is plotted for you. 3. Choose the graph that looks the most like yours A) E BAR GRAPH We will use a different type of graph to derive additional information from the CU, data (rig. nive). Average Yearly Rate of Observatory, Hawall interval Rate of increase per year 1959-1969 0.9 1969-1979 1979-1989 1989-1999 1999-2009 Figure A1.6.2 1999-2009 *- mrame -11- -n4 P2 جية 1989-1999 1979-1989 1969-1979 1959-1969 This bar drawn for you as an example 1.0 CO, Average Increase/Year (ppmv) B) E BAR GRAPH We will use a different type of graph to derive…arrow_forwardUse the relationships you just described to compute the values needed to fill in the blanks in the table in Fig A1.4.1 depth (a) 1.0 cml 0.7 cml cm| base dimensions (b, c)| 1.0 cm| 1.0 cm| 1.0 cm 1.0 cm| 1.0 cm| 1.0 cm volume (V) 1.0_cm' cm'| cm'| density (p) 1.0 g/cm'| 1.0 g/cm 1.0 g/cm' mass (m)| 0.3 g Column 1: depth at 1.0 cm volume mass Column 2: depth at 0.7 cm volume mass Column 3: unknown depth depth volumearrow_forward
- San Andreas Transform Boundary Plate Motion The geologic map below of southern California shows the position of the famous San Andreas Fault, a transform plate boundary between the North American Plate (east side) and the Pacific Plate (west side). The relative motion between the plates is indicated by the half arrows along the transform plate boundary (i.e., the Pacific Plate is moving to the northwest relative to the North American Plate). Note the two bodies of Oligocene volcanic rocks (labeled Ov) on the map in the previous page located along either side of the San Andreas Fault. These rocks are about 23.5 million years old and were once one body of rock. They have been separated by displacement along the fault. 21. Based on the offset of these volcanic rocks, what is the average annual rate of relative plate motion in cm/yr? SAF lab 2.jpg Group of answer choices 0.67 cm/yr 2 cm/yr 6.7 cm/yr 1.5 cm/yr CALIFORNIA Berkeley San Francisco K Os Q San Andreas Fault Ov…arrow_forwardThese are NOT part of any graded assignment. Are there other examples of synapomorphy. What is it called when the traits retained are similar to ancestors?arrow_forwardPlease hand draw everying. Thank you! Draw a gram positive bacterial cell below. Your cell should have the following parts, labeled: A coccus shape A capsule The gram positive cell wall should have the peptidoglycan labeled, as well as its component parts (NAM, NAG, and teichoic acid) A cell membrane Fimbriae A nucleoid Ribosomes Inclusionsarrow_forward
- Draw a gram negative bacterial cell below. Your cell should have the following parts, labeled: A bacillus shape Fimbriae Amphitrichous flagella 2 membranes (outer and inner) The outer membrane should have lipopolysaccharide (LPS) with lipid A and O antigens Periplasmic space The thin peptidoglycan cell wall between the 2 membranes A nucleoid Ribosomes Inclusionsarrow_forwardBacterial species Cell wall type Example: S. mitis Gram positive S. epidermidis H. pylori M. bovis S. marcescens Shape and arrangement Coccus, streptococcus Drawing 0000000arrow_forwardDraw a gram positive bacterial cell below. Your cell should have the following parts, labeled: A coccus shape A capsule The gram positive cell wall should have the peptidoglycan labeled, as well as its component parts (NAM, NAG, and teichoic acid) A cell membrane Fimbriae A nucleoid Ribosomes Inclusionsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License