Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 6, Problem 23ESP
Summary Introduction
To determine: The conclusion to the linkage experiments conducted on the mutants.
Introduction: The mutation is the change in the
Summary Introduction
To determine: The significance of part B of the experiment.
Introduction: Binary fission is the means of asexual reproduction opted by prokaryotes like bacteria to multiply and produce identical cells. The process is faster than the sexual reproduction and therefore, helps the bacteria to populate within a shorter period.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A classic way to isolate thymidylate synthase-negative mutants of
bacteria is to treat a growing culture with thymidine and trimetho-
prim. Most of the cells are killed, and the survivors are greatly
enriched in thymidylate synthase-negative mutants.
(a) What phenotype would allow you to identify these mutants?
(b) What is the biochemical rationale for the selection? (That is, why
are the mutants not killed under these conditions?)
(c) How would the procedure need to be modified to select mam-
malian cell mutants defective in thymidylate synthase?
A classic way to isolate thymidylate synthase-negative mutants of bacteria
is to treat a growing culture with thymidine and trimethoprim. Most of
the cells are killed, and the survivors are greatly enriched in thymidylate
synthase-negative mutants.
(a) What phenotype would allow you to identify these mutants?
(b) What is the biochemical rationale for the selection? (That is, why are the
mutants not killed under these conditions?)
(c) How would the procedure need to be modified to select mammalian cell
mutants defective in thymidylate synthase?
What order should the steps be in for this culture method?
Chapter 6 Solutions
Concepts of Genetics (12th Edition)
Ch. 6 - When the interrupted mating technique was used...Ch. 6 - In a transformation experiment involving a...Ch. 6 - In complementation studies of the rII locus of...Ch. 6 - A 4-month-old infant had been running a moderate...Ch. 6 - Prob. 2CSCh. 6 - Prob. 3CSCh. 6 - Prob. 4CSCh. 6 - HOW DO WE KNOW? In this chapter, we have focused...Ch. 6 - Review the Chapter Concepts list on p. 123. Many...Ch. 6 - With respect to F+ and F bacterial matings, answer...
Ch. 6 - List all major differences between (a) the F+ F...Ch. 6 - Describe the basis for chromosome mapping in the...Ch. 6 - In general, when recombination experiments are...Ch. 6 - Why are the recombinants produced from an Hfr F...Ch. 6 - Describe the origin of F bacteria and merozygotes.Ch. 6 - In a transformation experiment, donor DNA was...Ch. 6 - Describe the role of heteroduplex formation during...Ch. 6 - Explain the observations that led Zinder and...Ch. 6 - Prob. 12PDQCh. 6 - Two theoretical genetic strains of a virus (abc...Ch. 6 - The bacteriophage genome consists of many genes...Ch. 6 - If a single bacteriophage infects one E. coli cell...Ch. 6 - A phage-infected bacterial culture was subjected...Ch. 6 - In recombination studies of the rII locus in phage...Ch. 6 - In an analysis of rII mutants, complementation...Ch. 6 - If further testing of the mutations in Problem 18...Ch. 6 - Using mutants 2 and 3 from Problem 19, following...Ch. 6 - During the analysis of seven rII mutations in...Ch. 6 - In studies of recombination between mutants 1 and...Ch. 6 - Prob. 23ESPCh. 6 - An Hfr strain is used to map three genes in an...Ch. 6 - A plaque assay is performed beginning with 1 mL of...Ch. 6 - In a cotransformation experiment, using various...Ch. 6 - For the experiment in Problem 26, another gene, g,...Ch. 6 - Bacterial conjugation, mediated mainly by...Ch. 6 - A study was conducted in an attempt to determine...
Knowledge Booster
Similar questions
- Assume that a series of compounds has been discovered in Neurospora. Compounds A–F appear to be intermediates in a biochemical pathway. Conversion of one intermediate to the next is controlled by enzymes that are encoded by genes. Several mutations in these genes have been identified and Neurospora strains 1–4 each contain a single mutation. Strains 1–4 are grown on minimal media supplemented with one of the compounds A–F. The ability of each strain to grow when supplemented with different compounds is shown in the table (+ = growth; o = no growth). Which biochemical pathway fits the data presented? Media Supplement Strain A B C D E F 1 o o o + + + 2 o o o o + + 3 o o o o + o 4 o o + + + + A) A → B → C → D → E → F B) A → B → C → F → D → E C) F → B → C → D → A → E D) A → B → C → D → F → E E) A → B → F → E → C → Darrow_forwardClary Leonhart used the pET vector system to express her prokaryotic amylase enzyme. She added peptone into her culture broth of BL21 (DE3) Escherichia coli strain. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) Explain the reason why Clary failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Clary plans to express her protein along with a polyhistidine-tag, or better known by its trademarked name IIis-tag. Explain the importance of His-tag in protein work.arrow_forwardThe authors state: "Properties of the single mutants K557R, D591V and K617A, a double mutant, D591V/K617A, and a triple mutant, K557R/D591V/K617A, were evaluated to find an allosteric binding site for citrate." The numbers between the letters represent the residue number altered. The letter in front was the wild type and the letter afterwards is the mutant. How would the the triple mutations K557R and D591V and K617A alter the overall protein? O lower the # of charges, increase the pl O increase the # of charges, increase the pl O lower the # of charges, lower the pl O lower the # of charges, increase the pl O no change in the # of charges, increase the pl O no change in the # of charges, lower the plarrow_forward
- What is the simplest explanation for why patients have been identified with only one copy of the phosphofructokinase-1 gene (heterozygous), but no patients have been identified that lack both copies of the phosphofructokinase-1 gene (homozygous)? Patients lacking both copies of the phosphofructokinase-1 genes will be found once DNA sequencing technology can sequence whole genomes. Phosphofructokinase-1 is needed for nitrogen metabolism and there are no enzymes to replace this function, so cells die from ammonia toxicity. Phosphofructokinase-1 is a required enzyme for carbohydrate metabolism in all living cells, complete loss of this enzyme would be lethal. There are 6 phosphofructokinase-1 paralogous genes in humans and it is impossible to lack both type 1 copies when there are also types 4, 5, and 6.arrow_forwardThe following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of the gene or site missing from the table (blue numbers). + = wildtype, - = null mutation, c = constitutive, s =super repressor chromosome plasmid B-gal act. strain 10 Z A 1 C B 3 4 + C + 6 D 9 + 1 [Select] 3 [Select] 5 [Select] 7 [ Select] 9 [Select] | 0 2 + + 5 + 7 10 Z + -lac +lac 0.062 0.058 0.003 0.004 0.062 0.117 0.003 0.060 + 8 + 2 [Select] 4 [Select] 6 [Select] 8 [Select] 10 [Select]arrow_forwardLet’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.arrow_forward
- Mutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forwardClary Fray used the pET vector system to express her prokaryotic amylase enzyme. She added peptone into her culture broth of BL21(DE3) Escherichia coli strain to induce protein expression. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) (iii) (iv) (v) Explain the reason why Clary failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Clary plans to express her protein along with a polyhistidine-tag. Explain the importance of His-tag in protein work. Is DH5a Escherichia coli suitable to propagate the plasmid before protein expression? Besides heat shock method, elaborate another procedure Clary could utilize to transform the recombinant pET vector into the host cell. If her supervisor instructs her to express a gene from gold fish (Carassius auratus), is the expression system she is using now suitable for this experiment?…arrow_forwardThe cellulase gene of Bacillus licheniformis was successfully cloned into the pET21a vector and expressed in Escherichia coli BL21. The pET21a vector consists of ampicillin resistant gene. To screen for the successful transformants, E. coli BL21 was cultivated on LB agar containing ampicillin (100 pg/mL) and 0.5% (w/v) carboxymethylcellulose, and incubated at 37 0C for 6 hours. After that the agar plate was stained with Congo red solution for 15 minutes and washed twice with sodium chloride solution and the observation is as shown in Figure 3. Answer the following: (i.) Briefly explain why ampicillin was added to the LB agar. (ii) Indicate the function of carboxymethylcellulose in the LB agar. (iii) Conclude how the researchers were able to identify the E. coli BL21 that carried the cellulase gene.arrow_forward
- CTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mamma- lian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbal- anced nucleotide pools, and they have an elevated spontaneous mutation rate. Explain the likely basis for these observations.arrow_forwardMabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into her culture broth of DH5a Escherichia coli strain. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) Explain the reason why Mabelle failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Mabelle plans to express her protein fused to a polyhistidine-tag (His-tag). Explain the importance of His-tag in protein work.arrow_forwardIt is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education