
Concept explainers
A virus is a tiny infectious
- a. cell.
- b. living thing.
- c. particle.
- d.
nucleic acid .

Introduction:
Viruses are the small infectious particle that causes severe or mild infections in humans, plants, and animals. Viruses are not alive when they are present outside the host body. They need a host to reproduce or replicate. A virus contains a capsid (coat protein), nucleic acid, and an envelope (lipid membrane)
Answer to Problem 1MCQ
Correct answer:
A virus is a tiny microscopic infectious particle. Therefore, option (c) is correct.
Option (c) is given as “particle”.
Explanation of Solution
Justify reason for the correct statement:
Viruses are the lifeless molecule and unable to multiply independently from the host cell. They are not living, but when they are present in a host they possess certain processes of the living organismbut do not exhibit most of the processes. Therefore, viruses can be better described as the infectious particles rather than organisms.
Hence, option (c) is correct.
Justify reasons for the incorrect statements:
Option (a) is given as “cell”.
Viruses are not made of cells. Hence, it is a wrong answer.
Option (b) is given as “living thing”.
Viruses are not living things because they are unable to multiply or grow in number independently from the host cell. Hence, it is a wrong answer.
Option (d) is given as “nucleic acid”.
Viruses do contain a nucleic acid, but they cannot be defined as an infectious nucleic acid because it is one of a component of a virus. Hence, it is a wrong answer.
Hence, options (a),(b), and(d) are incorrect.
Hence, viruses can be defined as the tiny infectious particles.
Want to see more full solutions like this?
Chapter 6 Solutions
Microbiology: A Systems Approach
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning


