Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Question

Want to see the full answer?

Answer 1

Question

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Answer 6

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Answer 7

Chapter 6, Problem 5MCQ

Summary Introduction

Introduction:

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 6.1 - Describe the significance of viruses being...Ch. 6.2 - Summarize arguments on both sides of the debate...Ch. 6.2 - Identify effective terms to describe the behavior...Ch. 6.3 - Prob. 4AYP Ch. 6.3 - Describe the function and structure(s) of viral...Ch. 6.3 - Distinguish between enveloped and naked viruses.Ch. 6.3 - Prob. 7AYP Ch. 6.3 - Compare and contrast the composition of a viral...Ch. 6.3 - Diagram the possible nucleic acid configurations...Ch. 6.4 - Develop two arguments against assigning species...

Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.

Solution Summary: The author explains that a prophage is an inactive stage of the bacteriophage.

Concept explainers

Want to see the full answer?

Chapter 6 Solutions