
Which is a function of the skeletal system? (a) support, (b) hematopoietic site, (c) storage, (d) providing levers for muscle activity, (e) all of these.

To determine:
The function of skeletal system is
Support
Hematopoietic site
Storage
Providing levers for muscle activity
All of these
Answer to Problem 1MC
Solution:
(e) All of these: The function of the skeletal system is to provide lever to the muscles. Bones are the hematopoietic sites. They store nutrients and support the body.
Explanation of Solution
Explanation/ Justification for the correct answer:
The skeletal system in humans consists of 206 bones and a network of tendons and ligaments. The main functions of this system include the movement, support, protection, formation of various blood cells as well as the storage of calcium and other nutrients in the matrix, and endocrine regulation by releasing the hormone known as osteocalcin. Thus option (e) is a correct option.
Explanation for the incorrect answer:
Option (a) is given as support is the function of skeletal system. Skeletal system performs a number of functions like support, protection, formation of various blood cells, storage of nutrients and lever to the muscles. Here, only support is mentioned as a function of skeletal system, thus this option is considered as incorrect option.
Option (b) is given as skeletal system is a hematopoietic site. Skeletal system performs a number of functions like support, protection, formation of blood cells (hematopoietic site), storage of nutrients and lever to the muscles. Here, only hematopoietic site is mentioned as a function of skeletal system, thus this is considered as incorrect option.
Option (c) is given as storage is a function of skeletal system. Skeletal system performs a number of functions like support, protection, formation of various blood cells, storage of nutrients and lever to the muscles. Here, only storage is mentioned as a function of skeletal system, thus this is considered as incorrect option.
Option (d) is given as providing levers for muscle activity is a function of skeletal system. Skeletal system performs a number of functions like support, protection, formation of various blood cells, storage of nutrients and lever to the muscles. Here, only providing levers for muscle activity is mentioned, thus this is an incorrect option.
Thus it is concluded that skeletal system perform a number of functions such as support, protection, formation of various blood cells, storage of calcium and other nutrients and also provide lever to the muscles.
Want to see more full solutions like this?
Chapter 6 Solutions
Anatomy & Physiology (6th Edition)
Additional Science Textbook Solutions
Microbiology: An Introduction
Applications and Investigations in Earth Science (9th Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Organic Chemistry (8th Edition)
Human Physiology: An Integrated Approach (8th Edition)
Campbell Biology: Concepts & Connections (9th Edition)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning





