![GENETIC ANALYSIS: AN INTEG. APP. W/MAS](https://www.bartleby.com/isbn_cover_images/9781323142790/9781323142790_largeCoverImage.gif)
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 16P
Suppose you have an
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
When human hemoglobin undergoes a mutation, the
mutant protein usually does not replace all of the normal HbA in
the red blood cells or erythrocytes of the individual. The erythro-
cytes contain mixtures of varying amounts of both HbA and the
mutant protein depending on the mutation and the individual. Hb
Yakima is a mutant human Hb with an Asp-(B99)His mutation.
The diagram on the right shows that Hb Yakima was separated
by DEAE-cellulose chromatography from HbA with a 0 – 0.1 M
linear gradient of NaCl buffered to pH 8.3. Why is chromatog-
raphy carried out at pH 8.3? If the isoelectric point of HbA is 6.85,
what is the change in total charge caused by the mutation?How
does the change in charge explain the chromatography elution
profile of the Hb Yakima/HbA mixture?
1,5
-Hb-A
Hb -Yakima
1.0
0.5-
20
40
60
80
00
Fraction number
O.D578 nm
For each of the E. coli strains containing the lacoperon alleles listed, indicate whether the strain isinducible, constitutive, or unable to expressβ-galactosidase and permease.a. I+ o+ Z− Y+/ I+ ocZ+ Y+b. I+ o+ Z+ Y+/ I− ocZ+ Y−c. I+ o+ Z− Y+/ I− ocZ+ Y−d. I−P− o+ Z+ Y−/ I+ P+ ocZ− Y+e. Iso+ Z+ Y+/ I− o+ Z+ Y−
Genomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost.
What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)?
Probe 1
Probe 2
(a)
0.6kb
0.6kb and 1.2kb
(b)
0.6kb and 1.8kb
0.6kb, 1.2kb and 1.8kb
(c)
1.2kb
0.6kb
(d)
1.8kb
1.8kb
a.
(a)
b.
(b)
c.
(c)
d.
(d)
Chapter 6 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 6 - For bacteria that are F+, Hfr, F', and F-, perform...Ch. 6 - The flow diagram identifies relationships between...Ch. 6 - Conjugation between an Hfr cell and an F-cell does...Ch. 6 - Bacteria transfer genes by conjugation,...Ch. 6 - Explain the importance of the following features...Ch. 6 - Prob. 6PCh. 6 - Describe what is meant by the term site-specific...Ch. 6 - What is a prophage, and how is a prophage formed?Ch. 6 - How is the frequency of cotransduction related to...Ch. 6 - Describe the differences between genetic...
Ch. 6 - Among the mechanisms of gene transfer in bacteria,...Ch. 6 - What is lateral gene transfer? How might it take...Ch. 6 - Lateral gene transfer is thought to have played a...Ch. 6 - Prob. 14PCh. 6 - Prob. 15PCh. 6 - 16. Suppose you have an lysis mutant that maps to...Ch. 6 - Five Hfr strains from the same bacterial species...Ch. 6 - An interrupted mating study is carried out on Hfr...Ch. 6 - An Hfr strain with the genotype cys+leu+met+strS...Ch. 6 - A triple-auxotrophic strain of E. coli having the...Ch. 6 - Penicillin was first used in the 1940 s to treat...Ch. 6 - An attribute of growth behavior of eight...Ch. 6 - Synthesis of the amino acid histidine is a...Ch. 6 - The phage P1 is used as a generalized transducing...Ch. 6 - Prob. 25PCh. 6 - Five rII partial-deletion mutants are mapped and...Ch. 6 - A 2013 CDC report identified the practice of...Ch. 6 - Hfr strains that differ in integrated F factor...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X W CStrain 2: L A N C WStrain 3: A L B R UStrain 4: Z M U R BAll these Hfr strains are derived from the same F+ strain.What is the order of these markers on the circularchromosome of the original F+?arrow_forwardThe cellulase gene of Bacillus licheniformis was successfully cloned into the pET21a vector and expressed in Escherichia coli BL21. The pET21a vector consists of ampicillin resistant gene. To screen for the successful transformants, E. coli BL21 was cultivated on LB agar containing ampicillin (100 pg/mL) and 0.5% (w/v) carboxymethylcellulose, and incubated at 37 0C for 6 hours. After that the agar plate was stained with Congo red solution for 15 minutes and washed twice with sodium chloride solution and the observation is as shown in Figure 3. Answer the following: (i.) Briefly explain why ampicillin was added to the LB agar. (ii) Indicate the function of carboxymethylcellulose in the LB agar. (iii) Conclude how the researchers were able to identify the E. coli BL21 that carried the cellulase gene.arrow_forwardYou are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1? ( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.arrow_forward
- Schizosaccharomyces pombe, also known as "fission yeast," is a powerful model organism in molecular and cell biology. While performing a genetic screen, you discover an auxotrophic S. pombe strain that is unable to synthesize one or more vitamins. The following table represents the key experiments you performed during your genetic screen. Fill in the table with the outcome of each experiment for your mutant strain (using + for growth and - for no growth). Medium Rich media Minimal media Minimal media + all vitamins Minimal media + all amino acids Growth Wild-type + + + + Mutant + + + > > >arrow_forwardA fluctuation test was carried out to determine the rate of mutation to Azetidine resistance (a toxic proline analog) in S. typhimurium. Twenty tubes of rich medium were each inoculated with a few wild-type cells and the cultures were grown to 10° cells / ml. A 0.1 ml sample of each culture was then plated on each plate (a total of 20 plates) to detect AztR mutants. The results are shown in the following table. Calculate the mutation rate of S. typhimurium to AztR. Culture # # AztR mutants Culture # # AztR mutants 11 12 3 4. 13 14 15 4. 30 303 97 69 14 16 17 18 19 20 10 19arrow_forwardLet’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.arrow_forward
- In a cotransformation experiment (see question 4 of More GeneticTIPS), DNA was isolated from a donor strain that was proA+ andstrC+ and sensitive to tetracycline. (The proA and strC genes conferthe ability to synthesize proline and confer streptomycin resistance,respectively.) A recipient strain is proA− and strC− and isresistant to tetracycline. After transformation, the bacteria werefirst streaked on a medium containing proline, streptomycin, andtetracycline. Colonies were then restreaked on a medium containingstreptomycin and tetracycline. (Note: Each type of medium hadcarbon and nitrogen sources for growth.) The following resultswere obtained:70 colonies grew on the medium containing proline, streptomycin,and tetracycline, but only 2 of these 70 colonies grew whenrestreaked on the medium containing streptomycin and tetracyclinebut lacking proline. If we assume the average size of the DNA fragments is 2 minutes,how far apart are these two genes?arrow_forwardGive typing answer with explanation and conclusionarrow_forwardAfter mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B) that, unlike the wild type cells, fail to luminesce when grown to high density in a flask with appropriate medium. Curiously, however, when you inoculate both mutant strains in the same flask, you observe that the mixed (A+B) culture begins to emit light after growing dense. a) What gene/functions are likely affected in each of the two mutants? b) How does this explain their phenotypes?arrow_forward
- A research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T->A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTG СTGAGGCCACTCCTGGTCACCATGACAАССАCAGGCCCTCTТСAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAG CAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Bestriction enzyme Recognition sequence Nari GG/CGCC Ddel C/TOAG Hae II DGCGC/n Hpal cc/GG Alul AG/CT Smal ccc/GGG Mbol /GATC Mae II IGTDAC Bsp 1286 I GNGCn/c Hind II A/AGCTT ECOR I G/AATTC D: any Ducleotide 1:…arrow_forwardHis-64 is an amino acid in myoglobin's herne-binding pocket. It is called the "distal histidine." A scientigt conducted an experiment wherein she replaced His-64 with alanine. This mutation was designated H84AA. She also created two other mutants His64AP and His64AS. She then measured the oxygen-binding ability of each of these Mb variants. Her results are given below: (a) ) What is the role of the distal Histidine in oxygen binding? (b) ) On the graph above, observe the 4 Oxygen binding curves 1, 2, 3 and 4. Curve 1 represents normal (WT) Mb. i. Variant H644A is represented by curve #: il. Variant H64AP is represented by curve # ill. Variant H64AS is represented by curve #:(c) In 3-4 sentences, explain your answers to Part (b)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license