Concept explainers
To analyze:
An rII lysis mutation resulting from a point mutation is tested against numerous deletion mutations shown in the figure below that are able to form wild-type recombinants.
These deletion mutants are categorized in two groups named- series I and II.
The results are listed in the table below, “
Determine the segment of rII region that has lysis mutant by using the entire data of Series I.
Use the Series II data to locate the exact point mutation. Explain the justifications for the identified mutation location for both the data of series I and II.
Series I | Series II | ||
Deletion Mutation | Result | Deletion Mutation | Result |
Introduction:
The recombination frequency expresses the distance among genes. Least the recombination frequency, closer the genes are while greater recombination frequencies show that the gene distance is more.
Point mutation is either deletion or addition of a nucleotide in a sequence of gene, which has the ability to return in their wild type phenotype.
The deletion mutant line of
There are two types of mutants in
Want to see the full answer?
Check out a sample textbook solutionChapter 6 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
- A 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardA yeast geneticist irradiates haploid cells of a strain thatis an adenine-requiring auxotrophic mutant, caused bymutation of the gene ade1. Millions of the irradiatedcells are plated on minimal medium, and a small number of cells divide and produce prototrophic colonies.These colonies are crossed individually with a wildtype strain. Two types of results are obtained:(1) prototroph × wild type : progeny all prototrophic(2) prototroph × wild type : progeny 75% prototrophic,25% adenine-requiring auxotrophsa. Explain the difference between these two types ofresults.b. Write the genotypes of the prototrophs in each case.c. What progeny phenotypes and ratios do you predictfrom crossing a prototroph of type 2 by the original ade1auxotroph?arrow_forward
- The intermediates A, B, C, D, E, and F all occur in the same biochemical pathway G is the product of the pathway, and mutations 1 through 7 are all G –, meaning that they cannot produce substance G. The following table shows which intermediates will promote growth in each of the mutants. Arrange the intermediates in order of their occurrence in the pathway at which each mutant strain is blocked. A “+” in the table indicates that the strain will grow if given that substance, an “o” means lack of growth.arrow_forwardA gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.arrow_forwardGiven the following complementation chart for holes in Monstera, give me the biochemical (phenotype) pathway. A В D E Holes Class 1 + + + - - Class 2 + + Class 3 + + + Class 4 Class 5 + + - - + +arrow_forward
- There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…arrow_forwardA constitutive mutant is a strain that continuously makes aprotein that is inducible in the wild type. Describe two waysin which a change in a DNA molecule could lead to theemergence of a constitutive mutant. How could these twotypes of constitutive mutants be distinguished genetically?arrow_forwardA double mutant produced by uneven crossing-over contains two single nucleotide mutations that result in frame shifts and are separated by about 20 base pairs. The first is an insertion, while the second is a deletion. The amino acid sequences of the wildtype and mutant polypeptide in this region of the protein are as follows: Wildtype: Lys – Lys – Tyr – His – Gln – Trp – Thr – Cys – AsnDouble Mutant: Lys – Gln – Ile – Pro – Pro – Val – Asp – Met – Asn a) What are the original and double mutant mRNA sequences. You may find it useful to use the conventional symbols Y for pyrimidine, R for purine, N for any nucleotide, and H for A,C, or T. 2. b) Which nucleotide was inserted? 3. c) Which nucleotide was deleted?arrow_forward
- You have isolated 8 mutants in yeast that fail to grow on minimal media plates but do grow when they are supplemented with Arginine. You know that Arginine is synthesized in a biochemical pathway within wild-type yeast, but you do not know how many gene products it takes for the pathway. You have all of the lines as both a and a cells and mate each strain to each other in pairwise crosses and plate them on minimal media to see if they grow. You obtain the following results with (+) representing growth, and (-) indicating no growth: a 1 5 1 a 4 5 6 7 8 How many genes are represented? O 1 3 7 O Cannot tell from the data a + + + + + • + + i 0 +, + + + • + + 7 + + + + + , . + + + + + m + + + + + + + 2 + + + + + i + -I + + . . + + +arrow_forwardA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forwardConsider the following coding sequence transcribed from 5' to 3'5' A T G A A G C G C T C A G T A 3' If a guanine is substituted for nucleotide 11 what type of base substitution has occurred (nucleotide level) and what would be the resulting phenotypic effect?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education