Microbiology with Diseases by Taxonomy (5th Edition)
5th Edition
ISBN: 9780134019192
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 6, Problem 10FIB
Summary Introduction
Introduction:
Culturing microbes have helped in understanding more about specific diseases and isolation of causative agents. Microbes are cultured by adding inoculum which consists of cultured microbes which are added to nutrient media. The microbes that show growth from inoculum forms a culture. Cultures are grown on liquid (broth) or solid media.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 6 Solutions
Microbiology with Diseases by Taxonomy (5th Edition)
Ch. 6 - Prob. 1MCCh. 6 - In the laboratory, a sterile inoculating loop is...Ch. 6 - Superoxide dismutase _____________. a. causes...Ch. 6 - The most reactive of the four toxic forms of...Ch. 6 - Microaerophiles that grow best with a high...Ch. 6 - Prob. 6MCCh. 6 - Organisms that preferentially may thrive in icy...Ch. 6 - Prob. 8MCCh. 6 - Prob. 9MCCh. 6 - In a defined medium, ______________. a. the exact...
Ch. 6 - Prob. 11MCCh. 6 - Prob. 12MCCh. 6 - Prob. 13MCCh. 6 - Lyophilization can be described as ___________. a....Ch. 6 - Prob. 15MCCh. 6 - Prob. 1FIBCh. 6 - Prob. 2FIBCh. 6 - Prob. 3FIBCh. 6 - Prob. 4FIBCh. 6 - Prob. 5FIBCh. 6 - Prob. 6FIBCh. 6 - Prob. 7FIBCh. 6 - Prob. 8FIBCh. 6 - Prob. 9FIBCh. 6 - Prob. 10FIBCh. 6 - Prob. 11FIBCh. 6 - Prob. 1VICh. 6 - Prob. 2VICh. 6 - High temperature affects the shape of particular...Ch. 6 - Support or refute the following statement:...Ch. 6 - Prob. 3SACh. 6 - Why must media, vessels, and instruments be...Ch. 6 - Prob. 5SACh. 6 - Prob. 6SACh. 6 - Draw and label the four distinct phases of a...Ch. 6 - Prob. 8SACh. 6 - Prob. 9SACh. 6 - Prob. 10SACh. 6 - Explain the differences among photoautotrophs,...Ch. 6 - Prob. 12SACh. 6 - How does a chemostat maintain a constant...Ch. 6 - A scientist describes an organism as a...Ch. 6 - Pasteurization is a technique that uses...Ch. 6 - Prob. 3CTCh. 6 - Some organisms require riboflavin (vitamin B2) to...Ch. 6 - A scientist inoculates a bacterium into a complex...Ch. 6 - How can regions within biofilms differ in their...Ch. 6 - A scientific article describes a bacterium as an...Ch. 6 - Prob. 8CTCh. 6 - Prob. 9CTCh. 6 - Starting with 10 bacterial cells per milliliter in...Ch. 6 - Prob. 11CTCh. 6 - Prob. 12CTCh. 6 - The filamentous bacterium Beggiatoa gets its...Ch. 6 - Prob. 14CTCh. 6 - Examine the graph in Figure 6.3. Note that the...Ch. 6 - Prob. 16CTCh. 6 - Using the terms in Figure 6.8a, describe the...Ch. 6 - Prob. 18CTCh. 6 - Examine the ingredients of MacConkey agar as...Ch. 6 - Prob. 20CTCh. 6 - Using as many of the following terms as...Ch. 6 - Prob. 22CTCh. 6 - Viable plate counts are used to estimate...Ch. 6 - Using the following terms, fill in the following...Ch. 6 - Prob. 1TMWCh. 6 - Why do clinical laboratory scientists keep many...Ch. 6 - Prob. 3TMWCh. 6 - Culturing Microorganisms One of Kochs postulates...Ch. 6 - Clinical Case Study Boils in the Locker Room For...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license