Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 5.3, Problem 1MQ
In which phase of the growth curve do cells divide in a constant time period?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 5.1 - Define the term generation. What is meant by the...Ch. 5.1 - How do binary fission and budding cell division...Ch. 5.1 - How does the biofilm growth mode differ from that...Ch. 5.1 - Prob. 1CRCh. 5.2 - What is a semilogarithmic plot and what...Ch. 5.2 - For an exponentially growing culture that...Ch. 5.2 - For testing a bacteriums response to a toxic...Ch. 5.2 - How is the generation time (g) of an exponentially...Ch. 5.3 - In which phase of the growth curve do cells divide...Ch. 5.3 - Prob. 2MQ
Ch. 5.3 - Prob. 3MQCh. 5.3 - Describe the growth cycle of a population of...Ch. 5.4 - How do microorganisms in a chemostat differ from...Ch. 5.4 - What happens in a chemostat if the dilution rate...Ch. 5.4 - Do pure cultures have to be used in a chemostat?Ch. 5.4 - How does a chemostat regulate growth rate and cell...Ch. 5.5 - Why would a complex culture medium for Leuconostoc...Ch. 5.5 - In which medium shown in Table 5.1, defined or...Ch. 5.5 - What is meant by the word sterile? Why is aseptic...Ch. 5.5 - How many cells could be present in a single...Ch. 5.5 - Prob. 1CRCh. 5.6 - What are some of the problems that can arise when...Ch. 5.6 - Using microscopic techniques, how could you tell...Ch. 5.6 - Are total cell counts useful if one does not know...Ch. 5.7 - Why is a viable count more sensitive than a...Ch. 5.7 - Describe how you would dilute a bacterial culture...Ch. 5.7 - Prob. 3MQCh. 5.7 - How does a viable count differ from a total count?Ch. 5.8 - List two advantages of using turbidity as a...Ch. 5.8 - Describe how you could use a turbidity measurement...Ch. 5.8 - How can turbidity be used as a measure of cell...Ch. 5.9 - How does a hyperthermophile differ from a...Ch. 5.9 - Prob. 2MQCh. 5.9 - E. coli can grow at a higher temperature in a...Ch. 5.9 - Examine the graph in Figure 5.17. Why is the...Ch. 5.10 - Prob. 1MQCh. 5.10 - What molecular adaptations to cold temperatures...Ch. 5.10 - Prob. 1CRCh. 5.11 - Which phylogenetic domain includes species with...Ch. 5.11 - How does the membrane structure of...Ch. 5.11 - What is Taq polymerase and why is it important?Ch. 5.11 - How do cells of hyperthermophiles prevent heat...Ch. 5.12 - How does the concentration of H+ change when a...Ch. 5.12 - What terms are used to describe organisms whose...Ch. 5.12 - Prob. 3MQCh. 5.12 - Concerning the pH of the environment and of the...Ch. 5.13 - What is the aw of pure water? What is the lower...Ch. 5.13 - What are compatible solutes, and when and why are...Ch. 5.13 - How does a halophile maintain positive water...Ch. 5.14 - How does an obligate aerobe differ from a...Ch. 5.14 - How does a reducing agent work? Give an example of...Ch. 5.14 - How does Superoxide dismutase or superoxide...Ch. 5.14 - Contrast an aerotolerant and an obligate anaerobe...Ch. 5.15 - Why is heat an effective sterilizing agent?Ch. 5.15 - What steps are necessary to ensure the sterility...Ch. 5.15 - Distinguish between the sterilization of...Ch. 5.15 - Contrast the terms thermal death time and decimal...Ch. 5.16 - Define D10 and explain why the killing dose for...Ch. 5.16 - Prob. 2MQCh. 5.16 - Prob. 3MQCh. 5.16 - Prob. 1CRCh. 5.17 - Distinguish between the antimicrobial effects of...Ch. 5.17 - Describe how the minimum inhibitory concentration...Ch. 5.17 - Distinguish between a sterilant, a disinfectant,...Ch. 5.17 - Describe the procedure for obtaining the minimum...Ch. 5 - A medium was inoculated with 5 106 cells/ml of...Ch. 5 - Escherichia coli but not Pyrolobus fumarii will...Ch. 5 - In which direction (into or out of the cell) will...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY