Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 5.3, Problem 11ELO
Summary Introduction
To determine:
The structural features and functions of the two types of endoplasmic reticulum.
Introduction:
Endoplasmic reticulum (ER) is a distinguishing feature of eukaryotic cells. It occurs in the cell as an interconnected network of membranous hollow sacs that aid in synthesis and transport of various substances within the cell. There are two types of ER present in eukaryotic cells: smooth endoplasmic reticulum (SER) and rough endoplasmic reticulum (RER).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
Foundations in Microbiology
Ch. 5.1 - Describe the evolutionary history of eukaryotic...Ch. 5.1 - Provide a substantial theory regarding how...Ch. 5.1 - List the eukaryotic groups and their body plans.Ch. 5.1 - Prob. 1CYPCh. 5.1 - Which kingdoms of the five-kingdom system contain...Ch. 5.1 - How do unicellular, colonial, and multicellular...Ch. 5.2 - Describe the plan of a basic eukaryotic cell and...Ch. 5.2 - Describe the types of eukaryotic locomotor...Ch. 5.2 - Prob. 6ELOCh. 5.2 - Prob. 7ELO
Ch. 5.2 - Characterize the cell wall and membrane of...Ch. 5.2 - Prob. 4CYPCh. 5.2 - Which eukaryotic cells have a cell wall?Ch. 5.2 - Prob. 6CYPCh. 5.3 - Describe the structure of the nucleus and its...Ch. 5.3 - Prob. 10ELOCh. 5.3 - Prob. 11ELOCh. 5.3 - Prob. 12ELOCh. 5.3 - Summarize the stages in processing by the nucleus,...Ch. 5.3 - Describe the structure of a mitochondrion, and...Ch. 5.3 - Prob. 15ELOCh. 5.3 - Discuss features of eukaryotic ribosomes.Ch. 5.3 - Indicate the basic structure of the cytoskeleton,...Ch. 5.3 - Prob. 7CYPCh. 5.3 - Prob. 8CYPCh. 5.3 - Prob. 9CYPCh. 5.3 - Compare and contrast the smooth ΕR, the rough ER,...Ch. 5.3 - Compare the structures and functions of the...Ch. 5.3 - Prob. 12CYPCh. 5.3 - Prob. 13CYPCh. 5.3 - For what reasons would a cell need a "skeleton�?Ch. 5.4 - Compare and contrast prokaryotic cells, eukaryotic...Ch. 5.4 - Outline the basics of eukaryotic taxonomy.Ch. 5.4 - Explain what is meant by the term protist, and...Ch. 5.4 - Review the major differences and similarities...Ch. 5.5 - Prob. 21ELOCh. 5.5 - Prob. 22ELOCh. 5.5 - Prob. 23ELOCh. 5.5 - Prob. 24ELOCh. 5.5 - Prob. 25ELOCh. 5.5 - Prob. 26ELOCh. 5.5 - Prob. 16CYPCh. 5.5 - Prob. 17CYPCh. 5.5 - Prob. 18CYPCh. 5.5 - Prob. 19CYPCh. 5.5 - Prob. 20CYPCh. 5.5 - Prob. 21CYPCh. 5.6 - Prob. 27ELOCh. 5.6 - Describe several ways that algae are important...Ch. 5.6 - What is a working definition of a "protist"?Ch. 5.6 - Prob. 23CYPCh. 5.6 - How are algae important? Give examples of algae...Ch. 5.7 - Summarize the main characteristics of protozoan...Ch. 5.7 - Prob. 30ELOCh. 5.7 - Explain how protozoans are identified and...Ch. 5.7 - Prob. 32ELOCh. 5.7 - Prob. 33ELOCh. 5.7 - Explain the general characteristics of the...Ch. 5.7 - Describe the protozoan adaptations for feeding.Ch. 5.7 - Briefly outline the characteristics of the four...Ch. 5.7 - Prob. 28CYPCh. 5.8 - Prob. 34ELOCh. 5.8 - Explain the elements of helminth biology, life...Ch. 5.8 - Prob. 36ELOCh. 5.8 - Discuss the adaptations of parasitic worms to...Ch. 5.8 - Prob. 30CYPCh. 5.L1 - Prob. 1MCQCh. 5.L1 - Features of the nuclear envelope include a....Ch. 5.L1 - Prob. 3MCQCh. 5.L1 - What is embedded in rough endoplasmic reticulum?...Ch. 5.L1 - Prob. 5MCQCh. 5.L1 - Prob. 6MCQCh. 5.L1 - Prob. 7MCQCh. 5.L1 - Prob. 8MCQCh. 5.L1 - Prob. 9MCQCh. 5.L1 - Prob. 10MCQCh. 5.L1 - Prob. 11MCQCh. 5.L1 - Prob. 12MCQCh. 5.L1 - Prob. 13MCQCh. 5.L1 - Mitochondria likely originated from a. archaea b....Ch. 5.L1 - Prob. 15MCQCh. 5.L1 - Most helminth infections a. are localized to one...Ch. 5.L1 - Prob. 17MCQCh. 5.L1 - ________ Rhizopus a. the cause of malaria b....Ch. 5.L1 - Prob. 19MCQCh. 5.L1 - Prob. 20MCQCh. 5.L1 - ________ euglenid a. the cause of malaria b....Ch. 5.L1 - Prob. 22MCQCh. 5.L1 - ________ Trichomonas a. the cause of malaria b....Ch. 5.L1 - Prob. 24MCQCh. 5.L1 - Prob. 25MCQCh. 5.L1 - Prob. 26MCQCh. 5.L1 - Which of these is/are an example(s) of neglected...Ch. 5.L1 - Prob. 2CSRCh. 5.L1 - Prob. 3CSRCh. 5.L1 - Describe the anatomy and functions of each of the...Ch. 5.L1 - Trace the synthesis of cell products, their...Ch. 5.L1 - a. What is the reproductive potential of molds in...Ch. 5.L1 - a. Fill in the following summary table for...Ch. 5.L2 - Explain the ways that mitochondria resemble...Ch. 5.L2 - Prob. 2CTCh. 5.L2 - How are the eukaryotic ribosomes and cell...Ch. 5.L2 - Prob. 4CTCh. 5.L2 - Prob. 5CTCh. 5.L2 - Prob. 6CTCh. 5.L2 - a. How are bacterial endospores and cysts of...Ch. 5.L2 - For what reasons would a eukaryotic cell evolve an...Ch. 5.L2 - Prob. 9CTCh. 5.L2 - What term is used to describe a single species...Ch. 5.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license