
Investigating Biology Laboratory Manual (9th Edition)
9th Edition
ISBN: 9780134473468
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Judith Giles Morgan, M. Eloise Brown Carter
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 50, Problem 50.3CR
Summary Introduction
To review: How the vertebral brain processes sensory information obtained from vision differently than the sensory information from hearing and olfaction.
Introduction:
The mechanism in which the information is transmitted in the form of neurotransmitter in case of vision is when the light enters the cornea; it passes through pupil and iris. Then the light rays reach the vitreous humor and moves to the retina. The retina transmits the signals to the optic nerve, which further reaches the optic tract, optic radiation, and the cortex. After this, the signals reach to the occipital cortex and are interpreted as an image by the visual cortex.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 50 Solutions
Investigating Biology Laboratory Manual (9th Edition)
Ch. 50.1 - Which one of the five categories of sensory...Ch. 50.1 - Prob. 2CCCh. 50.1 - Prob. 3CCCh. 50.2 - How are otoliths adaptive for burrowing mammals,...Ch. 50.2 - Prob. 2CCCh. 50.2 - Prob. 3CCCh. 50.2 - Prob. 4CCCh. 50.3 - Contrast the light-detecting organs of planarians...Ch. 50.3 - Prob. 2CCCh. 50.3 - Prob. 3CC
Ch. 50.3 - Prob. 4CCCh. 50.4 - Explain why some taste receptor cells arid all...Ch. 50.4 - Prob. 2CCCh. 50.4 - Prob. 3CCCh. 50.5 - Contrast the role of Ca2+ in the contraction of a...Ch. 50.5 - Prob. 2CCCh. 50.5 - Prob. 3CCCh. 50.6 - Contrast swimming and flying in terms of the main...Ch. 50.6 - MAKE CONNECTIONS. Peristalsis contributes to the...Ch. 50.6 - WHAT IF? When using your arms to lower yourself...Ch. 50 - Sensory receptors transduce stimulus energy and...Ch. 50 - How are music volume and pitch encoded in signals...Ch. 50 - Prob. 50.3CRCh. 50 - Prob. 50.4CRCh. 50 - What are two major functions of ATP hydrolysis in...Ch. 50 - Which of the following sensory receptors is...Ch. 50 - The middle ear converts (A) air pressure waves to...Ch. 50 - Prob. 3TYUCh. 50 - Which sensory distinction is not encoded by a...Ch. 50 - The transduction of sound waves into action...Ch. 50 - Although some sharks close their eyes just before...Ch. 50 - Prob. 7TYUCh. 50 - EVOLUTION CONNECTION In general, locomotion on...Ch. 50 - Prob. 9TYUCh. 50 - WRITE ABOUT A THEME: ORGANIZATION In a short essay...Ch. 50 - SYNTHESIZE YOUR KNOWLEDGE Bloodhounds, which are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License