WHAT IS LIFE? A GUIDE TO BIO 3E+LAUNCHPA
3rd Edition
ISBN: 9781319103316
Author: PHELAN
Publisher: Macmillan Higher Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 5, Problem 5SA
Summary Introduction
To review:
The role of transcription and why translation is not the first step in using the information in the DNA.
Introduction:
The genetic material that is carried by each cell is guarded safely within the nucleus.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’.
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA?
Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls.
What happens to protein synthesis if a nonsense codon is inserted into the gene?
Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations)
Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA?
5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3'
Group of answer choices
3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5'
5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3'
5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3'
3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5'
3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
Chapter 5 Solutions
WHAT IS LIFE? A GUIDE TO BIO 3E+LAUNCHPA
Ch. 5 - Prob. 1SACh. 5 - Prob. 2SACh. 5 - Prob. 3SACh. 5 - Prob. 4SACh. 5 - Prob. 5SACh. 5 - Prob. 6SACh. 5 - Prob. 7SACh. 5 - Prob. 8SACh. 5 - Prob. 9SACh. 5 - Prob. 10SA
Ch. 5 - Prob. 11SACh. 5 - Prob. 12SACh. 5 - Prob. 13SACh. 5 - Prob. 14SACh. 5 - Prob. 15SACh. 5 - Prob. 1MCCh. 5 - Prob. 2MCCh. 5 - Prob. 3MCCh. 5 - Prob. 4MCCh. 5 - Prob. 5MCCh. 5 - Prob. 6MCCh. 5 - Prob. 7MCCh. 5 - Prob. 8MCCh. 5 - Prob. 9MCCh. 5 - Prob. 10MCCh. 5 - Prob. 11MCCh. 5 - Prob. 12MCCh. 5 - Prob. 13MCCh. 5 - Prob. 14MCCh. 5 - Prob. 15MCCh. 5 - Prob. 16MCCh. 5 - Prob. 17MC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following segment of a template strand of DNA: Part A -ATA AGC TTC GAC- What is the mRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) • Part C What is the mRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?arrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardif you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:arrow_forward
- Which of the following are features of transcription? -there is a direct interaction between nucleotides in the template DNA strand and incoming nucleotides being joined at the growing end of the RNA chain. -the RNA product remains permanently hydrogen-bonded to the template DNA strand. -the RNA being produced is elongated by addition of nucleotides at its 5' end. -the template DNA strand is "read" by RNA polymerase in a 3'-to-5' direction. -the site at which transcription starts is called the replication origin. More than one answer is right Please help me I’m confusedarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forwardIdentify whether each of the following descriptions applies to typical prokaryotic genomes only, typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used more than once or not at all. Composed of double-stranded DNA only. Each chromosome has a centromere. Species with larger genomes have more genes. [Choose ] [Choose ] prokaryotes only neither eukaryotes or prokaryotes eukaryotes only both prokaryotes and eukaryotes [Choose ]arrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardWhat is a gene? What does "base sequence" mean? If the base sequence of a segment of a molecule of DNA is changed, will the base sequence of the mRNA made during transcription be changed? If the base sequence of the mRNA is changed will the sequence of amino acids obtained during translation change? If the primary structure of a protein is changed, will it's function change? If the function of the protein changes, will the organism have a different characteristic? Do introns get read during translation?arrow_forwarda) DNA fragment with instructions b) code c) is transcribed but not translated d) non-coding e) sometimes encoding sometimes not gene, 5' UTR, exon, intron, ATTATTarrow_forward
- A segment of template DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Highlight the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. asap pleasearrow_forwardThe sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'arrow_forwardA certain template DNA strand has the following nucleotide sequence: 3’-TACTCGATGCTGTGCGAT-5’ a) What would be the nucleotide sequence of the complementary nontemplate DNA strand? What is this process called and where does this occur in the eukaryotic cell? b) Take the template strand through the process of transcription. What is the resulting strand called and where does this process occur in a eukaryotic cell. c) Take the template strand through the process of translation including the location in the cell. You should finish with a polypeptide chain. You will need to use the Genetic code found in your notes/bookarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license