HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 5, Problem 5.1.12AYLO
Summary Introduction
To analyze:
The difference between the papillary layer and the reticular layer.
Introduction:
The dermis is the middle layer of skin containing two layers. They are the papillary layer and the reticular layer.
Functions of the dermis are:
- Produces oil and wax to lubricate hair and skin.
- Produce sweat through sweat gland.
- Maintain body temperature.
- Produces hair through hair follicle gland.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 5 Solutions
HUMAN ANATOMY
Ch. 5.1 - Dermal papillae are relatively high and numerous...Ch. 5.1 - An infant brought to a clinic shows abnormally...Ch. 5.1 - Prob. 1BYGOCh. 5.1 - Prob. 2BYGOCh. 5.1 - List the five cell types of the epidermis....Ch. 5.1 - Prob. 4BYGOCh. 5.1 - What are the two layers of the dermis? What type...Ch. 5.1 - Name the pigments responsible for normal skin...Ch. 5.2 - Prob. 7BYGOCh. 5.2 - Prob. 8BYGO
Ch. 5.2 - Prob. 9BYGOCh. 5.2 - Prob. 10BYGOCh. 5.2 - Describe some similarities between a nail and a...Ch. 5.3 - Prob. 12BYGOCh. 5.3 - What types of hair are associated with apocrine...Ch. 5.3 - Prob. 14BYGOCh. 5.3 - What is the difference between a breast and...Ch. 5.4 - Prob. 1AWYKCh. 5.4 - What adult skin laver arises from the germinative...Ch. 5.4 - Prob. 17BYGOCh. 5.4 - What types of cells are involved in each type of...Ch. 5.4 - Which type of skin cancer is most dangerous? What...Ch. 5.4 - What is the difference between a first-, second-,...Ch. 5 - The difference between the integumentary system...Ch. 5 - Prob. 5.1.2AYLOCh. 5 - The range of thicknesses of the skin, the basis...Ch. 5 - Prob. 5.1.4AYLOCh. 5 - The five epidermal cell types and their respective...Ch. 5 - The four to five strata seen in thin and thick...Ch. 5 - Prob. 5.1.7AYLOCh. 5 - Prob. 5.1.8AYLOCh. 5 - Prob. 5.1.9AYLOCh. 5 - Prob. 5.1.10AYLOCh. 5 - Prob. 5.1.11AYLOCh. 5 - Prob. 5.1.12AYLOCh. 5 - The histological composition of the hypodermis and...Ch. 5 - Prob. 5.1.14AYLOCh. 5 - Prob. 5.1.15AYLOCh. 5 - The various kinds of lines, creases, and other...Ch. 5 - Prob. 5.2.1AYLOCh. 5 - Prob. 5.2.2AYLOCh. 5 - Prob. 5.2.3AYLOCh. 5 - Prob. 5.2.4AYLOCh. 5 - Prob. 5.2.5AYLOCh. 5 - Prob. 5.2.6AYLOCh. 5 - Prob. 5.2.7AYLOCh. 5 - Prob. 5.2.8AYLOCh. 5 - Prob. 5.2.9AYLOCh. 5 - Prob. 5.2.10AYLOCh. 5 - Types of hair thinning and factors that contribute...Ch. 5 - Prob. 5.2.12AYLOCh. 5 - The two types of sweat glands and how they differ...Ch. 5 - Prob. 5.3.2AYLOCh. 5 - Prob. 5.3.3AYLOCh. 5 - Prob. 5.3.4AYLOCh. 5 - Prob. 5.4.1AYLOCh. 5 - Prob. 5.4.2AYLOCh. 5 - Prob. 5.4.3AYLOCh. 5 - How the two types of sweat glands differ in their...Ch. 5 - Prob. 5.4.5AYLOCh. 5 - Prob. 5.4.6AYLOCh. 5 - Prob. 5.4.7AYLOCh. 5 - Prob. 1TYRCh. 5 - Prob. 2TYRCh. 5 - Prob. 3TYRCh. 5 - All of the following interfere with microbial...Ch. 5 - Prob. 5TYRCh. 5 - Prob. 6TYRCh. 5 - Prob. 7TYRCh. 5 - Prob. 8TYRCh. 5 - Prob. 9TYRCh. 5 - Prob. 10TYRCh. 5 - Prob. 11TYRCh. 5 - Prob. 12TYRCh. 5 - The most abundant protein of the epidermis is...Ch. 5 - Blueness of the skin due to low oxygen...Ch. 5 - Projections of the dermis toward the epidermis are...Ch. 5 - Cerumen is more commonly known as _____________.Ch. 5 - The holocrine glands that secret into a hair...Ch. 5 - The scaly outermost layer of a hair is called the...Ch. 5 - Prob. 19TYRCh. 5 - Prob. 20TYRCh. 5 - Prob. 1BYMVCh. 5 - Prob. 2BYMVCh. 5 - Prob. 3BYMVCh. 5 - Prob. 4BYMVCh. 5 - Prob. 5BYMVCh. 5 - Prob. 6BYMVCh. 5 - Prob. 7BYMVCh. 5 - Prob. 8BYMVCh. 5 - Prob. 9BYMVCh. 5 - State a meaning of each word element and give a...Ch. 5 - Prob. 1WWWTSCh. 5 - Prob. 2WWWTSCh. 5 - Prob. 3WWWTSCh. 5 - Prob. 4WWWTSCh. 5 - Briefly explain why each of the following...Ch. 5 - Prob. 6WWWTSCh. 5 - Prob. 7WWWTSCh. 5 - Prob. 8WWWTSCh. 5 - Prob. 9WWWTSCh. 5 - Prob. 10WWWTSCh. 5 - Many organs of the body contain numerous smaller...Ch. 5 - Prob. 2TYCCh. 5 - Prob. 3TYCCh. 5 - Prob. 4TYCCh. 5 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
The Integumentary System, Part 1 - Skin Deep: Crash Course Anatomy & Physiology #6; Author: CrashCourse;https://www.youtube.com/watch?v=Orumw-PyNjw;License: Standard youtube license