
Essentials of Human Anatomy & Physiology (12th Edition)
12th Edition
ISBN: 9780134395326
Author: Elaine N. Marieb, Suzanne M. Keller
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 40CT
Summary Introduction
To analyze:
A 75-year-old woman had stumbled while walking. The X-ray image revealed that the hip was broken, and so the patient was experiencing a terrible pain in the left hip. The probable condition of 75-year-old woman feeling a terrible pain in the left hip.
Introduction:
Bones have a low mass index and considered as dense and strong. In younger people, it is often observed that bones are thick and strong. While as the person grows older, it becomes thin and weakens. It sometimes gets broken. This condition is known as a fracture.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 5 Solutions
Essentials of Human Anatomy & Physiology (12th Edition)
Ch. 5 - Multiple Choice
More than one choice may...Ch. 5 - A passageway connecting neighboring osteocytes in...Ch. 5 - 3. Which of the following would you expect to be...Ch. 5 - Prob. 4MCCh. 5 - Prob. 5MCCh. 5 - Prob. 6MCCh. 5 - Which parts of the thoracic vertebrae articulate...Ch. 5 - Which of the following bones or bond parts...Ch. 5 - Which bone of the arm corresponds to the femur of...Ch. 5 - 10. At what stage of life do the lower limbs...
Ch. 5 - 11. Match the types of joints the descriptions...Ch. 5 - Match the bone markings listed on the right with...Ch. 5 - Prob. 13SAECh. 5 - What is yellow marrow? How do spongy and compact...Ch. 5 - Why do bone injuries heal much more rapidly than...Ch. 5 - 16. Compare and contrast the role of PTH (hormone)...Ch. 5 - 17. Which fracture types are most common in older...Ch. 5 - Prob. 18SAECh. 5 - 19. With one exception, all skull bones are joined...Ch. 5 - What facial bone forms the chin? The cheekbone?...Ch. 5 - 21. Name two ways in which the fetal skull differs...Ch. 5 - 22. How many vertebrae are there in each of the...Ch. 5 - Diagram the normal spinal curvatures and then the...Ch. 5 - 24. What is the function of the intervertebral...Ch. 5 - Name the major components of the thorax.Ch. 5 - Is a floating rib a true or a false rib? Why are...Ch. 5 - 27. Name the bones of the shoulder girdle.
Ch. 5 - 28. Name all the bones with which the ulna...Ch. 5 - What bones make up each hip bone (coxal bone)?...Ch. 5 - 30. Name the bones of the lower limb from superior...Ch. 5 - Compare the amount of movement possible in...Ch. 5 - Describe the structure of a synovial joint. Use...Ch. 5 - Prob. 33SAECh. 5 - Prob. 34SAECh. 5 - 35. List two factors that keep bones healthy. List...Ch. 5 - Contrast the location and characteristics of...Ch. 5 - A 75-year-old woman and her 9-year-old...Ch. 5 - Prob. 38CTCh. 5 - After having a severe cold accompanied by nasal...Ch. 5 - Prob. 40CTCh. 5 - Prob. 41CTCh. 5 - 42. An X-ray image of the arm of an accident...Ch. 5 - Prob. 43CTCh. 5 - A patient complains of pain starting in the jaw...Ch. 5 - Prob. 45CTCh. 5 - Prob. 46CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:CengageEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage