EBK CAMPBELL BIOLOGY
10th Edition
ISBN: 9780136539414
Author: Reece
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 3TYU
Summary Introduction
Introduction: An unsaturated fatty acid has double bonds in its fatty acid chain. Monounsaturated fats contain single double bonds and polyunsaturated fats contain two or more double bonds.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 5 Solutions
EBK CAMPBELL BIOLOGY
Ch. 5.1 - What are the four main classes of large biological...Ch. 5.1 - How many molecules of water are needed to...Ch. 5.1 - WHAT IF? If you eat a piece of fish, what...Ch. 5.2 - Write the formula for a monosaccharide that has...Ch. 5.2 - Prob. 2CCCh. 5.2 - WHAT IF? After a cow is given antibiotics to...Ch. 5.3 - Compare the structure of a fat (triglyceride) with...Ch. 5.3 - Why are human sex hormones considered lipids?Ch. 5.3 - Prob. 3CCCh. 5.4 - What parts of a polypeptide participate in the...
Ch. 5.4 - Prob. 2CCCh. 5.4 - WHAT IF? Where would you expect a polypeptide...Ch. 5.5 - Prob. 1CCCh. 5.5 - DRAW IT In a DNA double helix, a region along one...Ch. 5.6 - How would sequencing the entire genome of an...Ch. 5.6 - Given the function of DNA, why would you expect...Ch. 5 - What is the fundamental basis for the differences...Ch. 5 - Compare the composition, structure, and function...Ch. 5 - Why are lipids not considered to be polymers or...Ch. 5 - Explain the basis for the great diversity of...Ch. 5 - What role does complementary base pairing play in...Ch. 5 - Prob. 5.6CRCh. 5 - Prob. 1TYUCh. 5 - The enzyme amylase can break glycosidic linkages...Ch. 5 - Prob. 3TYUCh. 5 - The structural level of a protein least affected...Ch. 5 - Enzymes that break down DNA catalyze the...Ch. 5 - The molecular formula for glucose is C6H12O6. What...Ch. 5 - Which of the following pairs of base sequences...Ch. 5 - Construct a table that organizes the following...Ch. 5 - Prob. 9TYUCh. 5 - EVOLUTION CONNECTION Comparisons of amino acid...Ch. 5 - SCIENTIFIC INQUIRY Suppose you are a research...Ch. 5 - WRITE ABOUT A THEME: ORGANIZATION Proteins, which...Ch. 5 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
