Mindtap Biology, 1 Term (6 Months) Printed Access Card For Solomon/martin/martin/berg's Biology, 11th
11th Edition
ISBN: 9781337393096
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 45.5, Problem 3C
Summary Introduction
To describe: The basis of immunological memory.
Introduction: Immunity specifies the defense mechanisms carried out to protect the body from pathogens and other foreign substances that could harm the body by causing the disease or capable of altering the normal function of the system. There are two types of immunity: innate immunity (that is inherited from the parents) and acquired immunity (that is gained over a lifetime).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 45 Solutions
Mindtap Biology, 1 Term (6 Months) Printed Access Card For Solomon/martin/martin/berg's Biology, 11th
Ch. 45.1 - Prob. 1LOCh. 45.1 - Compare, in general terms, the immune responses...Ch. 45.1 - Prob. 1CCh. 45.1 - In general, how are vertebrate immune responses...Ch. 45.2 - Describe innate immune responses, including...Ch. 45.2 - Prob. 1CCh. 45.2 - Prob. 2CCh. 45.2 - Prob. 3CCh. 45.2 - VISUALIZE Draw a diagram illustrating the main...Ch. 45.3 - Prob. 4LO
Ch. 45.3 - Prob. 5LOCh. 45.3 - How are cell-mediated immunity and...Ch. 45.3 - Prob. 2CCh. 45.3 - Prob. 3CCh. 45.4 - Describe the sequence of events in cell-mediated...Ch. 45.4 - Prob. 1CCh. 45.5 - Summarize the sequence of events in...Ch. 45.5 - Prob. 8LOCh. 45.5 - Prob. 9LOCh. 45.5 - Prob. 10LOCh. 45.5 - Prob. 1CCh. 45.5 - Prob. 2CCh. 45.5 - Prob. 3CCh. 45.5 - Prob. 4CCh. 45.6 - Prob. 11LOCh. 45.6 - Describe examples of hypersensitivity, including...Ch. 45.6 - Prob. 1CCh. 45.6 - Prob. 2CCh. 45.6 - Prob. 3CCh. 45.6 - Prob. 4CCh. 45.6 - What is the immunological basis for graft...Ch. 45 - Innate immune responses include all but (a)...Ch. 45 - Cytokines (a) are regulatory Toll-like receptors...Ch. 45 - Which of the following is not an action of...Ch. 45 - Prob. 4TYUCh. 45 - Prob. 5TYUCh. 45 - Prob. 6TYUCh. 45 - Prob. 7TYUCh. 45 - Prob. 8TYUCh. 45 - Prob. 9TYUCh. 45 - Which sequence most accurately describes...Ch. 45 - VISUALIZE Label the following diagram and explain...Ch. 45 - Specificity, diversity, and memory are key...Ch. 45 - Prob. 13TYUCh. 45 - PREDICT A playmate in kindergarten exposes John...Ch. 45 - Prob. 15TYUCh. 45 - Prob. 16TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Information Storage and the Brain: Learning and Memory; Author: Professor Dave Explains;https://www.youtube.com/watch?v=PQDiUKwXLVI;License: Standard youtube license