BIOLOGY >PRINT UPGRADE<
11th Edition
ISBN: 9780357091586
Author: Solomon
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Question
Chapter 41.3, Problem 5LO
Summary Introduction
To compare: A graded potential and an action potential on the basis of their production and transmission.
Introduction: In the depolarization phase, potential difference is generated. The potential difference is of two types: the graded potential and the action potential. An action potential can be defined as a change in membrane potential resulting in signal transmission along the axon. Graded potential occurs due to change in membrane potential but is confined to a much smaller region.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 41 Solutions
BIOLOGY >PRINT UPGRADE<
Ch. 41.1 - Describe the processes involved in neural...Ch. 41.1 - Prob. 1CCh. 41.1 - Prob. 2CCh. 41.2 - Draw and label a typical neuron and give the...Ch. 41.2 - Prob. 3LOCh. 41.2 - Prob. 1CCh. 41.2 - Prob. 2CCh. 41.2 - Prob. 3CCh. 41.3 - Prob. 4LOCh. 41.3 - Prob. 5LO
Ch. 41.3 - Prob. 6LOCh. 41.3 - Prob. 1CCh. 41.3 - Prob. 2CCh. 41.3 - Prob. 3CCh. 41.3 - Prob. 4CCh. 41.4 - Prob. 7LOCh. 41.4 - Prob. 8LOCh. 41.4 - Prob. 9LOCh. 41.4 - Prob. 1CCh. 41.4 - Prob. 2CCh. 41.4 - How are EPSPs produced? IPSPs?Ch. 41.5 - Prob. 10LOCh. 41.5 - Prob. 1CCh. 41.5 - Prob. 2CCh. 41.5 - Prob. 3CCh. 41.6 - Prob. 11LOCh. 41.6 - Prob. 1CCh. 41 - Test Your Understanding Know and Comprehend 1....Ch. 41 - Prob. 2TYUCh. 41 - Test Your Understanding Know and Comprehend 3....Ch. 41 - Saltatory conduction (a) requires more energy than...Ch. 41 - Receptors for serotonin and many other...Ch. 41 - A presynaptic neuron in the cerebrum transmits...Ch. 41 - VISUALIZE Describe the action taking place at each...Ch. 41 - Prob. 8TYUCh. 41 - Prob. 9TYUCh. 41 - Prob. 10TYUCh. 41 - Prob. 11TYUCh. 41 - Prob. 12TYUCh. 41 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
What is a Primary and Secondary Metabolite?; Author: Unicity International;https://www.youtube.com/watch?v=TRNUURm0agM;License: Standard Youtube License