
Which of the following is stimulated by blue light?
a. Seed germination
b. Detection of plant spacing
c. Phototropism
d. Shoot elongation

Introduction:
The white light consists of the seven colors “violet”, “indigo”, “blue”, “green”, “yellow”, “orange”, and “red”. The blue color of the light has the wavelength equal to
Answer to Problem 1U
Correct answer:
The phototropism is stimulated by the blue light. Therefore, option c. is correct.
Explanation of Solution
Reason for the correct statement:
The direction of the feedback of the plant organs either in the direction of the light source or away from the light source is called phototropism. The blue light receptors are present on the plant organs, which direct the phototropism.
Option c. is given as “Phototropism”.
As, “the blue light influences the movement of plant organs, the plant organs in most of the cases show the positively phototropic movement”, it is the right answer.
Hence, option c. is correct.
Reasons for the incorrect statements:
Option a. is given as “Seed germination”.
The seed germination does not require the presence of light, as the seed germinates beneath the soil. So, it is a wrong answer.
Option b. is given as “Detection of plant spacing”.
The detection of the plant spacing is related to the far-red light exposure. This is not related to the blue light stimulation. So, it is a wrong answer.
Option d. is given as “Shoot elongation”.
The elongation of the shoot is regulated by the presence of a pigment, which is blue green in color. So, it is a wrong answer.
Hence, options a., b., and d. are incorrect.
The parts of the plants move positively from the stimulation by the blue light.
Want to see more full solutions like this?
Chapter 40 Solutions
Biology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning





