Concept explainers
a.
To determine: The proportion of the following-
- Vulcan
phenotypes for all three characters.
Introduction. Proportion means the percentage. The proportion of the genotypes means the percentage or the part among the whole proportion of the genes given in the linkage map. The proportion can be found by using the D. Harrison formula.
b.
To determine: The proportion of the following-
- Earth phenotypes for all three characters.
Introduction. The frequency of parental must be calculated first. Crossing over occurs approx 15 between P and A, which means occur 85 percent is left. Crossing over occurs approx 20 percent between A and R, and hence 80 percent left.
c.
To determine: The proportion of the following-
- Vulcan ears and heart but Earth adrenals
Introduction: Crossing over occurs approx 15 between P and A, which means occur 85 percent is remaining. Crossing over occurs approx 20 percent between A and R, and hence 80 percent left.
d.
To determine: The proportion of the following-
- Vulcan ears but Earth heart and adrenals.
Introduction: To find Vulcan ears and hearts and Earth adrenals, a crossover must occur in both regions, producing double crossovers

Want to see the full answer?
Check out a sample textbook solution
Chapter 4 Solutions
ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





