ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
12th Edition
ISBN: 9781319401399
Author: Griffiths
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 45P
Summary Introduction
To determine: The genotypes of the spores in unordered tetrads that are parental ditypes, tetratypes and nonparental ditypes.
Introduction. The law of independent assortment was given in a dihybrid cross which is the cross between the alleles of two pairs of contrasting characters. The alleles produced by each character are independent to combine with the alleles of the other character.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 4 Solutions
ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 30.1PCh. 4 - Prob. 30.2PCh. 4 - Prob. 30.3PCh. 4 - Prob. 30.4PCh. 4 - Prob. 30.5PCh. 4 - Prob. 30.6PCh. 4 - Prob. 30.7PCh. 4 - Prob. 30.8PCh. 4 - Prob. 30.9PCh. 4 - Prob. 30.10PCh. 4 - Prob. 30.11PCh. 4 - Prob. 30.12PCh. 4 - Prob. 30.13PCh. 4 - Prob. 30.14PCh. 4 - Prob. 30.15PCh. 4 - Prob. 30.16PCh. 4 - Prob. 30.17PCh. 4 - Prob. 30.18PCh. 4 - Prob. 30.19PCh. 4 - Prob. 30.20PCh. 4 - Prob. 30.21PCh. 4 - Prob. 30.22PCh. 4 - Prob. 30.23PCh. 4 - Prob. 30.24PCh. 4 - Prob. 30.25PCh. 4 - Prob. 30.26PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 47.1PCh. 4 - Prob. 47.2PCh. 4 - Prob. 47.3PCh. 4 - Prob. 47.4PCh. 4 - Prob. 47.5PCh. 4 - Prob. 47.6PCh. 4 - Prob. 47.7PCh. 4 - Prob. 47.8PCh. 4 - Prob. 47.9PCh. 4 - Prob. 47.10PCh. 4 - Prob. 47.11PCh. 4 - Prob. 47.12PCh. 4 - Prob. 47.13PCh. 4 - Prob. 47.14PCh. 4 - Prob. 47.15PCh. 4 - Prob. 47.16PCh. 4 - Prob. 47.17PCh. 4 - Prob. 47.18PCh. 4 - Prob. 47.19PCh. 4 - Prob. 47.20PCh. 4 - Prob. 47.21PCh. 4 - Prob. 47.22PCh. 4 - Prob. 47.23PCh. 4 - Prob. 47.24PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52PCh. 4 - Prob. 53PCh. 4 - Prob. 54PCh. 4 - Prob. 55PCh. 4 - Prob. 56PCh. 4 - Prob. 57PCh. 4 - Prob. 58PCh. 4 - Prob. 59PCh. 4 - Prob. 60PCh. 4 - Prob. 61PCh. 4 - Prob. 62PCh. 4 - Prob. 63PCh. 4 - Prob. 64PCh. 4 - Prob. 65PCh. 4 - Prob. 66PCh. 4 - Prob. 67PCh. 4 - Prob. 68PCh. 4 - Prob. 69PCh. 4 - Prob. 71PCh. 4 - Prob. 72PCh. 4 - Prob. 73PCh. 4 - Prob. 74PCh. 4 - Prob. 75PCh. 4 - Prob. 76PCh. 4 - Prob. 77PCh. 4 - Prob. 78PCh. 4 - Prob. 79PCh. 4 - Prob. 1GS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License