ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
12th Edition
ISBN: 9781319401399
Author: Griffiths
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 47.22P
Summary Introduction
To determine: The reason why problem state "centromere or centromeres" and not just "centromere".
Introduction: The centromere is the specialized DNA sequence of a chromosome that links a pair of sister chromatids. During mitosis, spindle fibers attach to the centromere via the kinetochore.
Summary Introduction
To determine: The general method for mapping centromeres in tetrad analysis.
Introduction: In some algae and
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 4 Solutions
ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 30.1PCh. 4 - Prob. 30.2PCh. 4 - Prob. 30.3PCh. 4 - Prob. 30.4PCh. 4 - Prob. 30.5PCh. 4 - Prob. 30.6PCh. 4 - Prob. 30.7PCh. 4 - Prob. 30.8PCh. 4 - Prob. 30.9PCh. 4 - Prob. 30.10PCh. 4 - Prob. 30.11PCh. 4 - Prob. 30.12PCh. 4 - Prob. 30.13PCh. 4 - Prob. 30.14PCh. 4 - Prob. 30.15PCh. 4 - Prob. 30.16PCh. 4 - Prob. 30.17PCh. 4 - Prob. 30.18PCh. 4 - Prob. 30.19PCh. 4 - Prob. 30.20PCh. 4 - Prob. 30.21PCh. 4 - Prob. 30.22PCh. 4 - Prob. 30.23PCh. 4 - Prob. 30.24PCh. 4 - Prob. 30.25PCh. 4 - Prob. 30.26PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 47.1PCh. 4 - Prob. 47.2PCh. 4 - Prob. 47.3PCh. 4 - Prob. 47.4PCh. 4 - Prob. 47.5PCh. 4 - Prob. 47.6PCh. 4 - Prob. 47.7PCh. 4 - Prob. 47.8PCh. 4 - Prob. 47.9PCh. 4 - Prob. 47.10PCh. 4 - Prob. 47.11PCh. 4 - Prob. 47.12PCh. 4 - Prob. 47.13PCh. 4 - Prob. 47.14PCh. 4 - Prob. 47.15PCh. 4 - Prob. 47.16PCh. 4 - Prob. 47.17PCh. 4 - Prob. 47.18PCh. 4 - Prob. 47.19PCh. 4 - Prob. 47.20PCh. 4 - Prob. 47.21PCh. 4 - Prob. 47.22PCh. 4 - Prob. 47.23PCh. 4 - Prob. 47.24PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52PCh. 4 - Prob. 53PCh. 4 - Prob. 54PCh. 4 - Prob. 55PCh. 4 - Prob. 56PCh. 4 - Prob. 57PCh. 4 - Prob. 58PCh. 4 - Prob. 59PCh. 4 - Prob. 60PCh. 4 - Prob. 61PCh. 4 - Prob. 62PCh. 4 - Prob. 63PCh. 4 - Prob. 64PCh. 4 - Prob. 65PCh. 4 - Prob. 66PCh. 4 - Prob. 67PCh. 4 - Prob. 68PCh. 4 - Prob. 69PCh. 4 - Prob. 71PCh. 4 - Prob. 72PCh. 4 - Prob. 73PCh. 4 - Prob. 74PCh. 4 - Prob. 75PCh. 4 - Prob. 76PCh. 4 - Prob. 77PCh. 4 - Prob. 78PCh. 4 - Prob. 79PCh. 4 - Prob. 1GS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License