
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 5RQ
Summary Introduction
To describe:
The functions of chloroplasts and mitochondria, the belief that these organelles arose from prokaryotic cells and also name this hypothesis.
Introduction:
The mitochondria are the cellular organelles that provide the cellular energy. The chloroplasts are the cellular organelles present in the plant and algal cells that help in the synthesis of the food.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 4 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 4.1 - trace the historical development of the cell...Ch. 4.1 - list the three principles of the cell theory?Ch. 4.2 - describe the structure and features shared by all...Ch. 4.2 - distinguish prokaryotic from eukaryotic cells?Ch. 4.2 - Prob. 1TCCh. 4.2 - Prob. 1CSCCh. 4.3 - describe the structure and function of the major...Ch. 4.3 - describe the internal features of bacteria,...Ch. 4.4 - Prob. 1CYLCh. 4.4 - list the structures found in animal but not plant...
Ch. 4.4 - describe the structure and function of each major...Ch. 4.4 - What problems would arise if the trachea were...Ch. 4.4 - Why do the chromosomes in chromatin condense in...Ch. 4.4 - Using Fig. E4 4. plot the changes in each country...Ch. 4.4 - Why is it advantageous for all cellular membranes...Ch. 4.4 - Why is it important for lysosomal enzymes to be...Ch. 4.4 - CONSIDER THIS What advantages do bioengineered...Ch. 4.4 - Over the years, scientists have wondered how many...Ch. 4 - Which of the following is/are found only in...Ch. 4 - Which of the following is not a function of the...Ch. 4 - Prob. 3MCCh. 4 - Prob. 4MCCh. 4 - Prob. 5MCCh. 4 - Prob. 1FIBCh. 4 - Prob. 2FIBCh. 4 - Prob. 3FIBCh. 4 - Prob. 4FIBCh. 4 - Prob. 5FIBCh. 4 - Two organelles that are believed to have evolved...Ch. 4 - Prob. 7FIBCh. 4 - Prob. 1RQCh. 4 - Prob. 2RQCh. 4 - Prob. 3RQCh. 4 - Describe the nucleus and the function of each of...Ch. 4 - Prob. 5RQCh. 4 - Prob. 6RQCh. 4 - Describe the structure and function of the...Ch. 4 - Prob. 8RQCh. 4 - Prob. 9RQCh. 4 - List the structures of bacterial cells that have...Ch. 4 - Prob. 1ACCh. 4 - Prob. 2ACCh. 4 - What problems would an enormous round cell...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
The Cell Cycle and its Regulation; Author: Professor Dave Explains;https://www.youtube.com/watch?v=eqJqhA8HSJ0;License: Standard YouTube License, CC-BY
Cell Division - Mitosis and Meiosis - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=w7vp_uRA8kw;License: Standard YouTube License, CC-BY