
Campbell Biology in Focus; Modified Mastering Biology with Pearson eText -- ValuePack Access Card -- for Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780134433776
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 39.6, Problem 1CC
Summary Introduction
To determine:
That the choice of the prey of the garter snake is evolved by the natural selection.
Introduction:
Behavioral differences can be observed in the same species based on the location where the species inhabit. This behavioral variation can lead to
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 39 Solutions
Campbell Biology in Focus; Modified Mastering Biology with Pearson eText -- ValuePack Access Card -- for Campbell Biology in Focus (2nd Edition)
Ch. 39.1 - Contrast the role of Ca2+ in the contraction of a...Ch. 39.1 - WHAT IF? Why are the muscles of an animal that has...Ch. 39.1 - Prob. 3CCCh. 39.2 - Prob. 1CCCh. 39.2 - Prob. 2CCCh. 39.2 - Prob. 3CCCh. 39.3 - Prob. 1CCCh. 39.3 - MAKE CONNECTIONS How is the lunar-linked rhythm of...Ch. 39.4 - How might associative learning explain why...Ch. 39.4 - Prob. 2CC
Ch. 39.4 - MAKE CONNECTIONS How might a learned behavior...Ch. 39.5 - Prob. 1CCCh. 39.5 - MAKE CONNECTIONS Balancing selection can maintain...Ch. 39.6 - Prob. 1CCCh. 39.6 - Prob. 2CCCh. 39 - During the contraction of a vertebrate skeletal...Ch. 39 - Prob. 2TYUCh. 39 - According to Hamiltons rule, A. natural selection...Ch. 39 - The binding of calcium to the troponin complex A....Ch. 39 - Curare, a substance that blocks the acetylcholine...Ch. 39 - Prob. 6TYUCh. 39 - Prob. 7TYUCh. 39 - SCIENTIFIC INQUIRY Propose a hypothesis to explain...Ch. 39 - SCIENTIFIC INQUIRY Scientists studying scrub jays...Ch. 39 - Prob. 10TYUCh. 39 - FOCUS ON INFORMATION Learning is defined as a...Ch. 39 - SYNTHESIZE YOUR KNOWLEDGE Acorn woodpeckers...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning


Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning