
Biology: Concepts and Investigations
4th Edition
ISBN: 9780078024207
Author: Mariëlle Hoefnagels Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 35.4, Problem 3MC
Summary Introduction
To describe:
The reasons for the symptomless infection with a sexually transmitted disease (STD) can be harmful.
Concept information:
Sexually transmitted disease spread through the unsafe sexual activities or by the blood transfusion from the infected person. Some diseases are symptom-less, they do not show any symptom, for example – Chlamydia; it is the sexually transmitted diseases caused by the bacteria Chlamydia trachomatis. It is called the “silent disease” as it does not show any symptom in 75% of infected females and 50% of infected males.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 35 Solutions
Biology: Concepts and Investigations
Ch. 35.1 - Prob. 1MCCh. 35.1 - Prob. 2MCCh. 35.1 - Prob. 3MCCh. 35.2 - Prob. 1MCCh. 35.2 - Prob. 2MCCh. 35.2 - Prob. 3MCCh. 35.2 - Prob. 4MCCh. 35.3 - Prob. 1MCCh. 35.3 - Prob. 2MCCh. 35.3 - How do hormones regulate the ovarian and menstrual...
Ch. 35.4 - Prob. 1MCCh. 35.4 - Prob. 2MCCh. 35.4 - Prob. 3MCCh. 35.5 - What are the events of fertilization?Ch. 35.5 - What are the relationships among the zygote,...Ch. 35.5 - What is implantation, and when does it occur?Ch. 35.5 - Prob. 4MCCh. 35.5 - Prob. 5MCCh. 35.5 - What are the events of the second and third...Ch. 35.5 - Prob. 7MCCh. 35.6 - Prob. 1MCCh. 35.6 - Prob. 2MCCh. 35.6 - Prob. 3MCCh. 35.7 - Prob. 1MCCh. 35.7 - Prob. 2MCCh. 35 - Prob. 1MCQCh. 35 - Which hormones play central roles in both male and...Ch. 35 - Prob. 3MCQCh. 35 - Why can't a fertilized polar body develop into a...Ch. 35 - Prob. 5MCQCh. 35 - Prob. 6MCQCh. 35 - What is the correct order of structures to develop...Ch. 35 - Prob. 8MCQCh. 35 - A baby born four weeks before its due date is most...Ch. 35 - A chemical that can cause a birth defect is a a....Ch. 35 - What is differentiation? How do protein gradients...Ch. 35 - Prob. 2WIOCh. 35 - Prob. 3WIOCh. 35 - Prob. 4WIOCh. 35 - What are the functions of LH and FSH in males and...Ch. 35 - Prob. 6WIOCh. 35 - Prob. 7WIOCh. 35 - Prob. 8WIOCh. 35 - Is each of the following cell types haploid or...Ch. 35 - Prob. 10WIOCh. 35 - Prob. 11WIOCh. 35 - What would happen if two sperm fertilized the same...Ch. 35 - Prob. 13WIOCh. 35 - Prob. 14WIOCh. 35 - Prob. 15WIOCh. 35 - Prob. 16WIOCh. 35 - Prob. 17WIOCh. 35 - Prob. 18WIOCh. 35 - Prob. 19WIOCh. 35 - Most physicians clamp and cut the umbilical cord...Ch. 35 - Prob. 21WIOCh. 35 - Prob. 22WIOCh. 35 - What kinds of studies and information would be...Ch. 35 - Review the Survey the Landscape figure in the...Ch. 35 - Add ovulation to the concept map. What hormonal...Ch. 35 - Prob. 3PITCh. 35 - Add the terms placenta, follicle, polar body,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningNutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
