LSC ANATOMY & PHYSIOLOGY CONNECT ACCESS
4th Edition
ISBN: 9781264929290
Author: McKinley
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 3.4, Problem 17WDYL
Summary Introduction
To determine:
The overall
Concept introduction:
The energy that we get is obtained from glucose. Glucose is broken down in cells partly in the cytosol and partly in the mitochondrion. The process of breakdown of glucose for the liberation of energy is done by
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 3 Solutions
LSC ANATOMY & PHYSIOLOGY CONNECT ACCESS
Ch. 3.1 - Both the movement of Na+ down its concentration...Ch. 3.1 - Muscle contraction is an example of what form of...Ch. 3.1 - Prob. 3WDYLCh. 3.2 - Prob. 4WDYLCh. 3.2 - For a biochemical reaction that involves simple...Ch. 3.2 - What molecule is formed from exergonic reactions...Ch. 3.2 - Explain what occurs when the equilibrium is...Ch. 3.2 - Explain the effect a fever would have on chemical...Ch. 3.3 - What is the relationship of enzymes and activation...Ch. 3.3 - What is the active site of an enzyme and how does...
Ch. 3.3 - What is the mechanism of enzyme action, including...Ch. 3.3 - Explain how enzymes are generally named.Ch. 3.3 - How do changes in substrate concentration,...Ch. 3.3 - How are enzymes regulated through competitive and...Ch. 3.3 - Prob. 15WDYLCh. 3.3 - Prob. 16WDYLCh. 3.4 - Prob. 17WDYLCh. 3.4 - Prob. 18WDYLCh. 3.4 - Prob. 19WDYLCh. 3.4 - Prob. 20WDYLCh. 3.4 - Prob. 21WDYLCh. 3.4 - Prob. 22WDYLCh. 3.4 - Prob. 23WDYLCh. 3.4 - Prob. 24WDYLCh. 3.4 - Prob. 25WDYLCh. 3.4 - Prob. 26WDYLCh. 3.4 - Prob. 27WDYLCh. 3.4 - Prob. 28WDYLCh. 3 - Energy in ATP is used to power skeletal muscle...Ch. 3 - Prob. 2DYKBCh. 3 - Prob. 3DYKBCh. 3 - ATP inhibits phosphofructokinase by binding to an...Ch. 3 - All of the following are accurate about enzymes...Ch. 3 - Prob. 6DYKBCh. 3 - Prob. 7DYKBCh. 3 - All stages of cellular respiration are decreased...Ch. 3 - Prob. 9DYKBCh. 3 - Prob. 10DYKBCh. 3 - Prob. 11DYKBCh. 3 - Describe the different ways of classifying...Ch. 3 - Prob. 13DYKBCh. 3 - Describe the structure and mechanism of enzymes.Ch. 3 - Prob. 15DYKBCh. 3 - Prob. 16DYKBCh. 3 - In general terms, explain the fate of pyruvate if...Ch. 3 - Describe how oxygen becomes part of water during...Ch. 3 - Identify the source of carbon in carbon dioxide.Ch. 3 - Prob. 20DYKBCh. 3 - Prob. 1CALCh. 3 - Prob. 2CALCh. 3 - Another challenge to a patient with impaired...Ch. 3 - Prob. 4CALCh. 3 - Prob. 5CALCh. 3 - Prob. 1CSLCh. 3 - Prob. 2CSLCh. 3 - What occurs to the amount of product formed in a...
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College