
Concept explainers
Which
- A. carboxyl
- B. sulfhydryl
- C. hydroxyl
- D. amino

Introduction:
The different properties of an organic molecule not only depend upon the carbon skeleton’s arrangement, it also depends on the different chemical groups attached to the skeleton.
Answer to Problem 1TYU
Correct answer:
The functional group that is not present in the given molecule is sulfhydryl group.
Therefore, option (B) is correct.
Explanation of Solution
Reason for the correct statement:
Sulfhydryl group is the functional group that comprises of a molecule of sulfur. Hence, the given structure does not have a sulfhydryl group.
Option (B) is given as “sulfhydryl”.
The “functional group that is not present in the given molecule is sulfhydryl group”, it is the right answer.
Hence, the option (B) is correct.
Reasons for the incorrect statements:
Option (A) is given as “carboxyl”.
The carboxyl functional group is present in the given molecule. So, it is a wrong answer.
Option (C) is given as “hydroxyl”.
The hydroxyl functional group is present in the given molecule. So, it is a wrong answer.
Option (D) is given as “amino”.
The amino group is present in the given molecule. So, it is a wrong answer.
Hence, options (A), (C), and (D) are incorrect.
The functional groups such as carboxyl, hydroxyl, and amino are present in the molecule, whereas the sulfhydryl group is absent in the given molecule.
Want to see more full solutions like this?
Chapter 3 Solutions
Campbell Biology in Focus
Additional Science Textbook Solutions
Biological Science (6th Edition)
College Physics: A Strategic Approach (3rd Edition)
Chemistry
Laboratory Manual For Human Anatomy & Physiology
SEELEY'S ANATOMY+PHYSIOLOGY
Biology: Life on Earth with Physiology (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College





