FOUNDATIONS IN MICROBIOLOGY (LL)
10th Edition
ISBN: 9781266031311
Author: TALARO
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 2.8, Problem 35CYP
35. What are the functions of RNA?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 2 Solutions
FOUNDATIONS IN MICROBIOLOGY (LL)
Ch. 2.1 - Prob. 1ELOCh. 2.1 - Prob. 2ELOCh. 2.1 - Prob. 3ELOCh. 2.1 - Prob. 4ELOCh. 2.1 - Prob. 5ELOCh. 2.1 - Prob. 1CYPCh. 2.1 - Prob. 2CYPCh. 2.1 - Prob. 3CYPCh. 2.1 - Prob. 4CYPCh. 2.1 - Prob. 5CYP
Ch. 2.1 - Prob. 6CYPCh. 2.2 - Prob. 6ELOCh. 2.2 - Prob. 7ELOCh. 2.2 - Prob. 8ELOCh. 2.2 - Prob. 9ELOCh. 2.2 - Prob. 10ELOCh. 2.2 - Prob. 11ELOCh. 2.2 - 7. Explain how the concepti of molecules and...Ch. 2.2 - Prob. 8CYPCh. 2.2 - Prob. 9CYPCh. 2.2 - Prob. 10CYPCh. 2.2 - Prob. 11CYPCh. 2.2 - Prob. 12CYPCh. 2.2 - Prob. 13CYPCh. 2.2 - Prob. 14CYPCh. 2.3 - Prob. 12ELOCh. 2.3 - 13. Explain solutes, solvents, and hydration.Ch. 2.3 - Prob. 14ELOCh. 2.3 - 15. Describe the pH scale and how it was derived;...Ch. 2.3 - Prob. 15CYPCh. 2.3 - Prob. 16CYPCh. 2.3 - 17. What properties of water make it an effective...Ch. 2.3 - Prob. 18CYPCh. 2.3 - 19. What determines whether a substance is an acid...Ch. 2.4 - 16. Describe the chemistry of carbon and the...Ch. 2.4 - Prob. 17ELOCh. 2.4 - Prob. 18ELOCh. 2.4 - Prob. 20CYPCh. 2.4 - Prob. 21CYPCh. 2.4 - Prob. 22CYPCh. 2.4 - 23. What are functional groups?Ch. 2.4 - Prob. 24CYPCh. 2.5 - 19. Define carbohydrate and know the functional...Ch. 2.5 - Prob. 20ELOCh. 2.5 - 21. Discuss the functions of carbohydrates in...Ch. 2.5 - Prob. 25CYPCh. 2.5 - Prob. 26CYPCh. 2.5 - 27. What are some of the functions of...Ch. 2.6 - 22. Define lipid, triglyceride, phospholipid,...Ch. 2.6 - 23. Describe how an ester bond is formed.Ch. 2.6 - Prob. 24ELOCh. 2.6 - 28. Draw simple structural molecules of...Ch. 2.7 - 25. Describe the structures of peptides and...Ch. 2.7 - 26. Characterize the four levels of protein...Ch. 2.7 - 27. Summarize some of the essential functions of...Ch. 2.7 - Prob. 29CYPCh. 2.7 - 30. Differentiate between a peptide, a...Ch. 2.7 - 31. Explain what causes the various levels of...Ch. 2.7 - 32. What functions do proteins perform in a cell?Ch. 2.8 - 28. Identify a nucleic acid and differentiate...Ch. 2.8 - Prob. 29ELOCh. 2.8 - 30. Explain how the DNA code may be copied, and...Ch. 2.8 - 33. Describe a nucleotide and a polynucleotide,...Ch. 2.8 - 34. Name the two purines and the three...Ch. 2.8 - 35. What are the functions of RNA?Ch. 2.8 - 36.What is ATP, and how does it function in cells?Ch. 2.L1 - 1. The smallest unit of matter with unique...Ch. 2.L1 - 2. The charge of a proton is exactly balanced by...Ch. 2.L1 - Prob. 3MCQCh. 2.L1 - Prob. 4MCQCh. 2.L1 - Prob. 5MCQCh. 2.L1 - Prob. 6MCQCh. 2.L1 - Prob. 7MCQCh. 2.L1 - 8. An atom that can donate electrons during a...Ch. 2.L1 - 9. In a solution of NaCl and water, NaCl is the...Ch. 2.L1 - 10. A solution with a pH of 2 than a solution with...Ch. 2.L1 - 11. Fructose is a type of a. disaccharide b....Ch. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L1 - 13. How is our understanding of microbiology...Ch. 2.L1 - 14. A phospholipid contains a. three fatty acids...Ch. 2.L1 - 15. Proteins are synthesized by linking amino...Ch. 2.L1 - 16. The amino acid that accounts for disulfide...Ch. 2.L1 - 17. DNA is a hereditary molecule that is composed...Ch. 2.L1 - 18. What is meant by the term DMA replication? a....Ch. 2.L1 - 19. Proteins can function as a. enzymes b....Ch. 2.L1 - 20. RNA plays an important role in what biological...Ch. 2.L1 - 1. Which of the following has not been a major...Ch. 2.L1 - 2. What was a significant result of the Mars...Ch. 2.L1 - Prob. 3CSRCh. 2.L1 - Prob. 1WCCh. 2.L1 - Prob. 2WCCh. 2.L1 - Prob. 3WCCh. 2.L1 - Prob. 4WCCh. 2.L1 - Prob. 5WCCh. 2.L1 - 6. Why are hydrogen bonds relatively weak?Ch. 2.L1 - 7. What kind of substances will be expected to be...Ch. 2.L1 - Prob. 8WCCh. 2.L1 - Prob. 9WCCh. 2.L1 - 10. What makes the amino acids distinctive, and...Ch. 2.L1 - Prob. 11WCCh. 2.L1 - Prob. 12WCCh. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L2 - Prob. 1CTCh. 2.L2 - Prob. 2CTCh. 2.L2 - Prob. 3CTCh. 2.L2 - 4. Distinguish between polar and ionic compounds.Ch. 2.L2 - 5. Is galactose an aldehyde or a ketone sugar?Ch. 2.L2 - 6. a. How many water molecules are released when a...Ch. 2.L2 - Prob. 7CTCh. 2.L2 - Prob. 8CTCh. 2.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license