
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27.4, Problem 17CYP
Summary Introduction
Introduction:
Temperature plays a great role in food preservation. High heat helps destroy spore and sterilize foods while regular refrigeration can inhibit microbial growth, increasing the shelf life of food product.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 27 Solutions
Foundations in Microbiology
Ch. 27.1 - Prob. 1ELOCh. 27.1 - Outline the steps in treatment of municipal water...Ch. 27.1 - Prob. 3ELOCh. 27.1 - Draw a diagram of the flow of water in a utility...Ch. 27.1 - Prob. 2CYPCh. 27.1 - Prob. 3CYPCh. 27.1 - Prob. 4CYPCh. 27.1 - Prob. 5CYPCh. 27.1 - How does treatment of drinking water and sewage...Ch. 27.2 - Prob. 4ELO
Ch. 27.3 - Characterize the basic science behind the use of...Ch. 27.3 - Describe the microbiological processes involved in...Ch. 27.3 - Outline the fermentation processes related to the...Ch. 27.3 - Explain several ways that microbes may be used as...Ch. 27.4 - Prob. 9ELOCh. 27.4 - Prob. 10ELOCh. 27.4 - Prob. 11ELOCh. 27.4 - Prob. 12ELOCh. 27.4 - Prob. 7CYPCh. 27.4 - Prob. 8CYPCh. 27.4 - Outline the steps in beer making.Ch. 27.4 - List the steps in wine making.Ch. 27.4 - Prob. 11CYPCh. 27.4 - Prob. 12CYPCh. 27.4 - Describe five types of fermentations.Ch. 27.4 - What are the main criteria regarding the safety of...Ch. 27.4 - Prob. 15CYPCh. 27.4 - Prob. 16CYPCh. 27.4 - Prob. 17CYPCh. 27.5 - Prob. 13ELOCh. 27.5 - Describe industrial fermentations and the role of...Ch. 27.5 - Outline the steps in industrial mass production of...Ch. 27.5 - Prob. 16ELOCh. 27.5 - Prob. 18CYPCh. 27.5 - Prob. 19CYPCh. 27.5 - What is meant by biotransformation?Ch. 27.5 - Prob. 21CYPCh. 27.5 - Explain what is meant by downstream processing.Ch. 27.5 - List some specific examples of products derived...Ch. 27.L1 - Prob. 1MCQCh. 27.L1 - Milk is usually pasteurized by a. the...Ch. 27.L1 - Substances given off by yeasts during fermentation...Ch. 27.L1 - Which of the following is added to facilitate milk...Ch. 27.L1 - Prob. 5MCQCh. 27.L1 - Prob. 6MCQCh. 27.L1 - Prob. 7MCQCh. 27.L1 - Prob. 8MCQCh. 27.L1 - The large tanks used in industrial production of...Ch. 27.L1 - Prob. 10MCQCh. 27.L1 - Prob. 1CSRCh. 27.L1 - Prob. 2CSRCh. 27.L1 - If the bacterium in question during the perlo...Ch. 27.L1 - Prob. 1WCCh. 27.L1 - Summarize the basic processes in food...Ch. 27.L1 - Outline the major methods used to prevent...Ch. 27.L1 - Prob. 4WCCh. 27.L2 - Describe three important potential applications of...Ch. 27.L2 - Prob. 2CTCh. 27.L2 - a. What is the purpose of boiling the wort in beer...Ch. 27.L2 - Prob. 4CTCh. 27.L2 - Explain the ways that biotransformation by...Ch. 27.L2 - Log on to http: //www.cdc.gofv/pulseiiety to learn...Ch. 27.L2 - Prob. 1VCCh. 27.L2 - From chapter 8, Figure 8.23. Correlate the stages...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Nitrogen emissions: environmental and health hazards; Author: Sandec Eawag;https://www.youtube.com/watch?v=iYcchHZ5Ejo;License: Standard Youtube License