
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27.L1, Problem 1CSR
Summary Introduction
To review:
The ingredient that should be added to chopped garlic that is sold dipped in olive oil.
Introduction:
since garlic contains endospores of C. botulinum there are high chances of being infected by botulism. In many canned vegetables such as tomatoes, the low pH destroys the spores.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 27 Solutions
Foundations in Microbiology
Ch. 27.1 - Prob. 1ELOCh. 27.1 - Outline the steps in treatment of municipal water...Ch. 27.1 - Prob. 3ELOCh. 27.1 - Draw a diagram of the flow of water in a utility...Ch. 27.1 - Prob. 2CYPCh. 27.1 - Prob. 3CYPCh. 27.1 - Prob. 4CYPCh. 27.1 - Prob. 5CYPCh. 27.1 - How does treatment of drinking water and sewage...Ch. 27.2 - Prob. 4ELO
Ch. 27.3 - Characterize the basic science behind the use of...Ch. 27.3 - Describe the microbiological processes involved in...Ch. 27.3 - Outline the fermentation processes related to the...Ch. 27.3 - Explain several ways that microbes may be used as...Ch. 27.4 - Prob. 9ELOCh. 27.4 - Prob. 10ELOCh. 27.4 - Prob. 11ELOCh. 27.4 - Prob. 12ELOCh. 27.4 - Prob. 7CYPCh. 27.4 - Prob. 8CYPCh. 27.4 - Outline the steps in beer making.Ch. 27.4 - List the steps in wine making.Ch. 27.4 - Prob. 11CYPCh. 27.4 - Prob. 12CYPCh. 27.4 - Describe five types of fermentations.Ch. 27.4 - What are the main criteria regarding the safety of...Ch. 27.4 - Prob. 15CYPCh. 27.4 - Prob. 16CYPCh. 27.4 - Prob. 17CYPCh. 27.5 - Prob. 13ELOCh. 27.5 - Describe industrial fermentations and the role of...Ch. 27.5 - Outline the steps in industrial mass production of...Ch. 27.5 - Prob. 16ELOCh. 27.5 - Prob. 18CYPCh. 27.5 - Prob. 19CYPCh. 27.5 - What is meant by biotransformation?Ch. 27.5 - Prob. 21CYPCh. 27.5 - Explain what is meant by downstream processing.Ch. 27.5 - List some specific examples of products derived...Ch. 27.L1 - Prob. 1MCQCh. 27.L1 - Milk is usually pasteurized by a. the...Ch. 27.L1 - Substances given off by yeasts during fermentation...Ch. 27.L1 - Which of the following is added to facilitate milk...Ch. 27.L1 - Prob. 5MCQCh. 27.L1 - Prob. 6MCQCh. 27.L1 - Prob. 7MCQCh. 27.L1 - Prob. 8MCQCh. 27.L1 - The large tanks used in industrial production of...Ch. 27.L1 - Prob. 10MCQCh. 27.L1 - Prob. 1CSRCh. 27.L1 - Prob. 2CSRCh. 27.L1 - If the bacterium in question during the perlo...Ch. 27.L1 - Prob. 1WCCh. 27.L1 - Summarize the basic processes in food...Ch. 27.L1 - Outline the major methods used to prevent...Ch. 27.L1 - Prob. 4WCCh. 27.L2 - Describe three important potential applications of...Ch. 27.L2 - Prob. 2CTCh. 27.L2 - a. What is the purpose of boiling the wort in beer...Ch. 27.L2 - Prob. 4CTCh. 27.L2 - Explain the ways that biotransformation by...Ch. 27.L2 - Log on to http: //www.cdc.gofv/pulseiiety to learn...Ch. 27.L2 - Prob. 1VCCh. 27.L2 - From chapter 8, Figure 8.23. Correlate the stages...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning