
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 6CONQ
Summary Introduction
To review:
A. Genotype f requency of normal and cystic fibrosis (CF) allele.
B. Frequency of homozygous normal, heterozygous, and homozygous affected individuals.
C. Probability of choosing a heterozygous mate by a heterozygous carrier individual.
Introduction:
Allele frequency refers to the rate of frequency of an allele or gene that is present in a given population. Gene pool is defined as the sum of all the genome of the populations. For the calculation of genotype or allele frequency, the characters such as dominant and recessive traits are taken into consideration.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 27 Solutions
Genetics: Analysis and Principles
Ch. 27.1 - A gene pool is a. all of the genes in a single...Ch. 27.1 - 2. In natural populations, most genes...Ch. 27.1 - A gene exists in two alleles designatedDandd. If...Ch. 27.1 - Prob. 4COMQCh. 27.2 - Which of the following is a factor that, by...Ch. 27.3 - 1. Darwinian fitness is a measure...Ch. 27.3 - 2. Within a particular population, darkly colored...Ch. 27.3 - 3. A population occupies heterogeneous...Ch. 27.3 - Prob. 4COMQCh. 27.4 - 1. Genetic drift is
a. a change in allele...
Ch. 27.4 - 2. Which of the following influences on genetic...Ch. 27.5 - Gene flow depends on a. migration. b. the ability...Ch. 27.6 - 1. Inbreeding is sexual reproduction between...Ch. 27.7 - The mutation rate is a. the likelihood that a new...Ch. 27.7 - 2. The transfer of an antibiotic resistance gene...Ch. 27.7 - Prob. 3COMQCh. 27 - 1. What is the gene pool? How is a gene pool...Ch. 27 - Prob. 2CONQCh. 27 - Prob. 3CONQCh. 27 - Prob. 4CONQCh. 27 - The termpolymorphismcan refer to both genes and...Ch. 27 - Prob. 6CONQCh. 27 - For a gene existing in two alleles, what are the...Ch. 27 - 8. In a population, the frequencies of two...Ch. 27 - The ability to roll your tongue is inherited as a...Ch. 27 - What evolutionary factors can cause allele...Ch. 27 - What is the difference between a neutral and an...Ch. 27 - Prob. 12CONQCh. 27 - Prob. 13CONQCh. 27 - Describe the similarities and differences among...Ch. 27 - 15. Is each of the following examples due to...Ch. 27 - Prob. 16CONQCh. 27 - Prob. 17CONQCh. 27 - 18. A group of four birds flies to a new location...Ch. 27 - 19. Describe what happens to allele frequencies as...Ch. 27 - With regard to genetic drift, are the following...Ch. 27 - When two populations frequently intermix due to...Ch. 27 - Two populations of antelope are separated by a...Ch. 27 - Prob. 23CONQCh. 27 - 24. Using the pedigree shown here, answer the...Ch. 27 - A family pedigree is shown here. A. What is the...Ch. 27 - 26. A family pedigree is shown here.
A. What is...Ch. 27 - Prob. 27CONQCh. 27 - Prob. 28CONQCh. 27 - 1. You will need to be familiar with the...Ch. 27 - You will need to refer to question 2 in More...Ch. 27 - Prob. 3EQCh. 27 - Prob. 4EQCh. 27 - You will need to refer to question 2 in More...Ch. 27 - Prob. 6EQCh. 27 - Prob. 7EQCh. 27 - In the Grants study of the medium ground finch, do...Ch. 27 - 9. A recessive lethal allele has achieved a...Ch. 27 - Among a large population of 2 million gray...Ch. 27 - In a donor population, the allele frequencies for...Ch. 27 - Prob. 12EQCh. 27 - Prob. 13EQCh. 27 - Prob. 14EQCh. 27 - 15. What would you expect to be the minimum...Ch. 27 - Discuss examples of positive and negative...Ch. 27 - Discuss the role of mutation in the origin of...Ch. 27 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Mendelian Genetics and Punnett Squares; Author: Professor Dave Explains;https://www.youtube.com/watch?v=3f_eisNPpnc;License: Standard YouTube License, CC-BY
The Evolution of Populations: Natural Selection, Genetic Drift, and Gene Flow; Author: Professor Dave Explains;https://www.youtube.com/watch?v=SRWXEMlI0_U;License: Standard YouTube License, CC-BY