Laboratory Experiments in Microbiology (11th Edition)
11th Edition
ISBN: 9780321994936
Author: Ted R. Johnson, Christine L. Case
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 1CA
Summary Introduction
To determine:
The conclusion of the data given.
The disease cause by V. cholerae.
The value of the experiment.
Introduction:
V. choleraeis an infectious agent which infects the small intestine of mammals. It is a may lead to a sever condition, when it is not treated properly.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The volume of E. coli added to each warm agar pour/virus mixture was originally100µL. After pre-testing the experiment, the instructions were modified for you to add 300µL of E. coli. Make an educated guess as to why the volume was increased.
You got an opportunity to join a professor lab who is working in-vivo model and specifically looking at the dysregulation of mitochondria in liver. He asked you to isolate mitochondria from a Rat liver and placed in an assay medium. Based on the knowledge you gain in this course so far, please answer the following questions:
a) Which technique will you use to isolate mitochondria?
b) What happens to the pH of the medium when the medium is kept anaerobic?
c) What happens when O2-saturated saline is added to the mixture?
You have isolated a beta-lactamase producing Staphylococcus aureus (not a MRSA strain) from an
infected surgical site on your patient.
If for genetic reasons, your patient is allergic to all antibiotics except beta-lactam antibiotics such as
ampicillin ( they can only take Beta-lactam antibiotics such as ampicillin), which strategy below
could
you use to treat this Staphylococcus aureus infection in your patient? Note different answers
compared to previous question.
give the patient erythromycin
can use a beta-lactamse resistant beta-lactam such as methicillin or oxacillin
O give the patient penicillin
give the patient an azole drug
Chapter 27 Solutions
Laboratory Experiments in Microbiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Bacillus subtilis is known to harbour proA gene which is expressed as protease. Protease is an industrially important enzyme but the yield from Bacillus is not satisfactory. What processes of genetic engineering can you conduct to increase the production of proA gene? Briefly discuss your vision on the context.arrow_forwardYou perform a Minimum Inhibitory Concentration (MIC) assay on a bacterium that you have isolated from a patient, with the results shown below (white material = bacterial growth). Which of the following is NOT a correct statement about these results? Erythromycin Gentamicin Concentration (ug/ml) 300 None of the other four answers (All statements are true 200 A lower concentration of erythromycin than gentamicin will inhibit growth of this bacterium The MIC for gentamicin was not determined in this test The MIC for erythromycin was 50ug/ml The bacterium was resistant to gentamicin at all concentrations testedarrow_forwardIn the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain pneumonia solutions were added to non-virulent R Strain pneumonia cell cultures and allowed to grow in liquid media (i.e., broth). In tubes where Protease was added to the supernatant prior to cell culture, what was the observed effect when plating and growing the S. pneumonia cells to solid media? Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. a b C d e All RNA was degraded and Transformation of the R Strain to S Strain occurred. All Protein was degraded and Transformation of the R Strain to S Strain occurred. All DNA was degraded and Transformation of the R Strain to S Strain occurred. All RNA was degraded and no Transformation occurred indicating RNA is the molecule of Transformation inheritance None of the above are truearrow_forward
- The sequence shown below is an actual sequence of the toxin gene from Salmonella enterica subspecies serovar Typhimurium strain obtained from the NCBI database. ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG CAAAAACTAA (i) Is the nucleotide sequence above translatable into a complete protein? Give justification. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer. (iii) Liliana, a research officer would like to perform a multiple sequence alignment between the sequence above with eight other toxin genes sequences obtained from other researchers. Define multiple sequence alignment. (iv) Which multiple sequence alignment program would you recommend…arrow_forwardAssume that you counted 67 plaques on a bacterial plate where 0.1ml of a 10-5 dilution of phage was added to bacterial culture. What is the initial concentration of the undiluted phage? Show your calculations and give your answer in pfu/ml (pfu = plaque-forming units)arrow_forwardWhat is the genus and species of your bacteria? And What led you to confirm this result and why? Please discuss. ☆My bacteria is Alcaligenes faecalisarrow_forward
- A graduate student was assaying LD50 (lethal dose 50%) of two temperature-sensitive Francisella tularensis strains in HeLa cells (human cell line). Both strains can infect humans and cause fatal tularemia if untreated, but it is difficult to obtain LD50 values in human subjects. The data below shows LD50 (lethal dose 50%) values of the strains in human cell culture. Can you predict the more virulent strain of the two human pathogens? Francisella tularensis strain A: LD50 @ 20°C= 100; LD50 @ 37°C= 1000 Francisella tularensis strain B: LD50 @ 20°C= 1000 LD 50 @ 37°C= 100 O It is not possible to determine the virulence of the two strains as human pathogens from the provided data Strain A and strain B are equally virulent as human pathogens, as they average out in virulence. O Strain A is more virulent than strain A as a human pathogen. O Strain B is more virulent than strain A as a human pathogen.arrow_forwardA graduate student was assaying LD50 (lethal dose 50%) of two temperature-sensitive Francisella tularensis strains in HeLa cells (human cell line). Both strains can infect humans and cause fatal tularemia if untreated, but it is difficult to obtain LD50 values in human subjects. The data below shows LD50 (lethal dose 50%) values of the strains in human cell culture. Can you predict the more virulent strain of the two human pathogens? Francisella tularensis strain A: LD50 @ 20∘C= 100; LD50 @ 37∘C= 1000 Francisella tularensis strain B: LD50 @ 20∘C= 1000 LD50 @ 37∘C= 100 Group of answer choices It is not possible to determine the virulence of the two strains as human pathogens from the provided data Strain A and strain B are equally virulent as human pathogens, as they average out in virulence. Strain A is more virulent than strain A as a human pathogen. Strain B is more virulent than strain A as a human pathogen.arrow_forwardYou have conducted serial 10-fold dilutions and measured the cfu (colony forming units) of a Streptococcus pneumoniae culture and also the pfu (plaque forming units) of a phage (virus) that infects the bacteria. You counted 5 cfu in a 0.4 ml sample of a 106 dilution of the bacterial sample. You then counted 50 plaque-forming units (pfu) in a 0.25 ml sample of a 108 diluted sample of the phage culture. What are the cfu/ml of the S. pneumoniae and pfu/ml of the phage cultures before dilution? 5 x 106 cfu/ml and 2 x 109 pfu/ml 4 x 107 CFU/ml and 2 x 109 PFU/ml 1.25 x 108 cfu/ml and 10 x 1010 pfu/ml 1.25 x 107 cfu/ml and 2 x 1010 pfu/mlarrow_forward
- Bacillus thuringiensis makes toxins that kill insects. These toxins must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one strategy is to apply bacteria directly to leaves.However,B. thuringiensis does not survive very long in thefield. Other bacteria, such as Pseudomonas syringae, do survive.Propose a way to alter P. syringae so it could be used as an insecticide.Discuss advantages and disadvantages of this approach compared with the repeated applications of the toxins from B. thuringiensis.arrow_forwardTRY TO KEEP IN SHORT AND USE OWN WORD FOR THIS QUESTION You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You subject two batches of the same bacteria type to different environmental growth conditions. One batch is grown at pH 2, while the other is grown at pH 7. All other environmental parameters are kept identical between the two batches. You then collect their proteins and run a Western blot using an antibody that binds to a proton efflux pump protein (which actively expends energy to pump protons out of a cell). How would you characterize the information obtained in this experiment? What does it tell you, and why is that potentially valuable information?arrow_forwardIn a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? There is no way to know given the information provided Both infections are equally likely Donoteatum thisbacterium Parasiticum mucoidesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
12DaysinMarch, Genital Infections for USMLE Step One; Author: Howard Sachs;https://www.youtube.com/watch?v=66zR_FypVFQ;License: Standard youtube license