
Anatomy & Physiology
3rd Edition
ISBN: 9781259398629
Author: McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher: Mcgraw Hill Education,
expand_more
expand_more
format_list_bulleted
Question
Chapter 26.1, Problem 5WDL
Summary Introduction
To determine:
The difference between peristalsis and mixing.
Concept introduction:
Muscularis layer of GI tract is made up of two smooth muscle layer in which the cells of inner smooth muscle layer are arranged in the wall of GI tract circumferentially forming the “inner circular layer”. The cells of outer smooth muscle are arranged as “outer longitudinal layer”. The contraction of these two layers forces ingested food to move along the GI tract in two types of movement: mixing and peristalsis.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
hoose a scientist(s) and research their contribution to our
derstanding of DNA structure or replication. Write a one page
port and include:
their research
where they studied and the time period in which they worked
their experiments and results
the contribution to our understanding of DNA
cientists
Watson & Crick
7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no
other carbon source and no acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
3
For each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2)
Consult the total catabolic pathways on the last page as a reference for the following questions.
A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)?
B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the
electron transport chain: 3ATP/NADH, 2ATP/FADH2
C. How much ATP is made by substrate level phosphorylation (SLP)?
D. How much total ATP is made? Add the SLP and OP together.
1. Aerobic respiration using 0.5 mole of glucose?
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
Chapter 26 Solutions
Anatomy & Physiology
Ch. 26.1 - LEARNING OBJECTIVE
1. Identify the six organs that...Ch. 26.1 - LEARNING OBJECTIVE
2. List the accessory digestive...Ch. 26.1 - Prob. 1WDLCh. 26.1 - LEARNING OBJECTIVE
3. List and describe the six...Ch. 26.1 - What is the primary difference between mechanical...Ch. 26.1 - Prob. 4LOCh. 26.1 - Prob. 5LOCh. 26.1 - Prob. 6LOCh. 26.1 - What specific layer(s) must substances cross to...Ch. 26.1 - Prob. 4WDL
Ch. 26.1 - Prob. 5WDLCh. 26.1 - Prob. 7LOCh. 26.1 - Prob. 8LOCh. 26.1 - Prob. 9LOCh. 26.1 - Prob. 6WDLCh. 26.1 - Prob. 7WDLCh. 26.1 - LEARNING OBJECTIVE
10. Describe the structure of...Ch. 26.1 - Prob. 11LOCh. 26.1 - LEARNING OBJECTIVE
12. Explain the function of the...Ch. 26.1 - Prob. 1WDTCh. 26.1 - What is the difference between intraperitoneal and...Ch. 26.1 - Where is the greater omentum located?Ch. 26.2 - Prob. 13LOCh. 26.2 - Prob. 10WDLCh. 26.2 - Prob. 14LOCh. 26.2 - LEARNING OBJECTIVE
15. Describe the structure and...Ch. 26.2 - Prob. 16LOCh. 26.2 - Prob. 17LOCh. 26.2 - Prob. 2WDTCh. 26.2 - Prob. 11WDLCh. 26.2 - Prob. 18LOCh. 26.2 - Prob. 12WDLCh. 26.2 - How is the bolus moved from the oral cavity into...Ch. 26.2 - Prob. 19LOCh. 26.2 - Prob. 20LOCh. 26.2 - Prob. 21LOCh. 26.2 - Prob. 3WDTCh. 26.2 - Prob. 14WDLCh. 26.2 - Prob. 15WDLCh. 26.3 - Prob. 22LOCh. 26.3 - What organs are considered part of the lower GI...Ch. 26.3 - Prob. 23LOCh. 26.3 - Prob. 24LOCh. 26.3 - Prob. 25LOCh. 26.3 - Prob. 4WDTCh. 26.3 - What are the three anatomic structures that...Ch. 26.3 - WHAT DID YOU LEARN?
18 Which type of motility is...Ch. 26.3 - Prob. 26LOCh. 26.3 - Prob. 27LOCh. 26.3 - Prob. 28LOCh. 26.3 - Prob. 5WDTCh. 26.3 - Where do deoxygenated, nutrient-rich blood and...Ch. 26.3 - Prob. 20WDLCh. 26.3 - Prob. 21WDLCh. 26.3 - Prob. 29LOCh. 26.3 - Prob. 30LOCh. 26.3 - Prob. 31LOCh. 26.3 - Prob. 22WDLCh. 26.3 - Prob. 23WDLCh. 26.3 - Which substances are typically absorbed by the...Ch. 26.4 - LEARNING OBJECTIVE
32. Name the three classes of...Ch. 26.4 - Prob. 33LOCh. 26.4 - Prob. 34LOCh. 26.4 - Prob. 25WDLCh. 26.4 - Prob. 35LOCh. 26.4 - Prob. 36LOCh. 26.4 - Prob. 37LOCh. 26.4 - How are proteolytic enzymes activated in the...Ch. 26.4 - LEARNING OBJECTIVE
38. Explain the role of bile...Ch. 26.4 - LEARNING OBJECTIVE
39. Discuss the process by...Ch. 26.4 - What is the function of bile salts in lipid...Ch. 26.4 - WHAT DID YOU LEARN?
28 How do micelles and...Ch. 26.4 - Prob. 40LOCh. 26.4 - Prob. 29WDLCh. 26.4 - Prob. 41LOCh. 26.4 - Prob. 42LOCh. 26.4 - WHAT DID YOU LEARN?
30 Explain the details of...Ch. 26 - _____ 1. Which organ is located in the right upper...Ch. 26 - _____ 2. The _____ cells of the stomach are...Ch. 26 - _____ 3. Which of the following is an unregulated...Ch. 26 - _____ 4. Which organ (or part of an organ) is...Ch. 26 - _____ 5. Pancreatic juice contains a. HCO3 and...Ch. 26 - _____ 6. Bile is transported through the a....Ch. 26 - _____ 7. Digestion of proteins begins in the a....Ch. 26 - Prob. 8DYBCh. 26 - _____ 9. Digestive enzymes that chemically digest...Ch. 26 - _____ 10. Most of the absorption of our digested...Ch. 26 - The GI tract from the esophagus to the anal canal...Ch. 26 - Discuss the reason why the involuntary sequence of...Ch. 26 - Prob. 13DYBCh. 26 - Compare the structure of the circular folds,...Ch. 26 - Discuss why the tunica mucosa in the colon has a...Ch. 26 - Prob. 16DYBCh. 26 - What is the role of the gallbladder in digestion?Ch. 26 - Describe the different forms of mechanical...Ch. 26 - Prob. 19DYBCh. 26 - How are lipids absorbed in the GI tract?Ch. 26 - Prob. 1CALCh. 26 - Prob. 2CALCh. 26 - What component of the digestive tract can you not...Ch. 26 - The pancreatic ducts are blocked with a thick,...Ch. 26 - Prob. 5CALCh. 26 - Alexandra experienced vomiting and diarrhea and...Ch. 26 - A key event in the chemical digestion processes...Ch. 26 - Most cases of colorectal cancer occur in the most...
Knowledge Booster
Similar questions
- Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure below. Use the information below to determine how much ATP will be produced from the glycerol part of the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your total number of ATP produced per lipid. Assume no other carbon source is available. 18 carbons fatty acids 12 carbons glycerol . Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration. glycerol glycerol-3- phosphate…arrow_forwardDon't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forward
- Biology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forwardWrite the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forward
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage