
Loose Leaf For Anatomy & Physiology: An Integrative Approach
3rd Edition
ISBN: 9781260162493
Author: McKinley Dr., Michael; O'Loughlin, Valerie; Bidle, Theresa
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 26.1, Problem 11LO
Summary Introduction
To distinguish: Intraperitoneal and retroperitoneal organs.
Concept introduction: The space between the parietal and visceral peritoneum is known as peritoneal cavity which secretes the serous fluid. This fluid provides lubrication to both the external surface of organs and the internal wall of the abdomen. On the basis of the peritoneum covering, the digestive organs are classified as intraperitoneal and retroperitoneal organs.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 26 Solutions
Loose Leaf For Anatomy & Physiology: An Integrative Approach
Ch. 26.1 - LEARNING OBJECTIVE
1. Identify the six organs that...Ch. 26.1 - LEARNING OBJECTIVE
2. List the accessory digestive...Ch. 26.1 - Prob. 1WDLCh. 26.1 - LEARNING OBJECTIVE
3. List and describe the six...Ch. 26.1 - What is the primary difference between mechanical...Ch. 26.1 - Prob. 4LOCh. 26.1 - Prob. 5LOCh. 26.1 - Prob. 6LOCh. 26.1 - What specific layer(s) must substances cross to...Ch. 26.1 - Prob. 4WDL
Ch. 26.1 - Prob. 5WDLCh. 26.1 - Prob. 7LOCh. 26.1 - Prob. 8LOCh. 26.1 - Prob. 9LOCh. 26.1 - Prob. 6WDLCh. 26.1 - Prob. 7WDLCh. 26.1 - LEARNING OBJECTIVE
10. Describe the structure of...Ch. 26.1 - Prob. 11LOCh. 26.1 - LEARNING OBJECTIVE
12. Explain the function of the...Ch. 26.1 - Prob. 1WDTCh. 26.1 - What is the difference between intraperitoneal and...Ch. 26.1 - Where is the greater omentum located?Ch. 26.2 - Prob. 13LOCh. 26.2 - Prob. 10WDLCh. 26.2 - Prob. 14LOCh. 26.2 - LEARNING OBJECTIVE
15. Describe the structure and...Ch. 26.2 - Prob. 16LOCh. 26.2 - Prob. 17LOCh. 26.2 - Prob. 2WDTCh. 26.2 - Prob. 11WDLCh. 26.2 - Prob. 18LOCh. 26.2 - Prob. 12WDLCh. 26.2 - How is the bolus moved from the oral cavity into...Ch. 26.2 - Prob. 19LOCh. 26.2 - Prob. 20LOCh. 26.2 - Prob. 21LOCh. 26.2 - Prob. 3WDTCh. 26.2 - Prob. 14WDLCh. 26.2 - Prob. 15WDLCh. 26.3 - Prob. 22LOCh. 26.3 - What organs are considered part of the lower GI...Ch. 26.3 - Prob. 23LOCh. 26.3 - Prob. 24LOCh. 26.3 - Prob. 25LOCh. 26.3 - Prob. 4WDTCh. 26.3 - What are the three anatomic structures that...Ch. 26.3 - WHAT DID YOU LEARN?
18 Which type of motility is...Ch. 26.3 - Prob. 26LOCh. 26.3 - Prob. 27LOCh. 26.3 - Prob. 28LOCh. 26.3 - Prob. 5WDTCh. 26.3 - Where do deoxygenated, nutrient-rich blood and...Ch. 26.3 - Prob. 20WDLCh. 26.3 - Prob. 21WDLCh. 26.3 - Prob. 29LOCh. 26.3 - Prob. 30LOCh. 26.3 - Prob. 31LOCh. 26.3 - Prob. 22WDLCh. 26.3 - Prob. 23WDLCh. 26.3 - Which substances are typically absorbed by the...Ch. 26.4 - LEARNING OBJECTIVE
32. Name the three classes of...Ch. 26.4 - Prob. 33LOCh. 26.4 - Prob. 34LOCh. 26.4 - Prob. 25WDLCh. 26.4 - Prob. 35LOCh. 26.4 - Prob. 36LOCh. 26.4 - Prob. 37LOCh. 26.4 - How are proteolytic enzymes activated in the...Ch. 26.4 - LEARNING OBJECTIVE
38. Explain the role of bile...Ch. 26.4 - LEARNING OBJECTIVE
39. Discuss the process by...Ch. 26.4 - What is the function of bile salts in lipid...Ch. 26.4 - WHAT DID YOU LEARN?
28 How do micelles and...Ch. 26.4 - Prob. 40LOCh. 26.4 - Prob. 29WDLCh. 26.4 - Prob. 41LOCh. 26.4 - Prob. 42LOCh. 26.4 - WHAT DID YOU LEARN?
30 Explain the details of...Ch. 26 - _____ 1. Which organ is located in the right upper...Ch. 26 - _____ 2. The _____ cells of the stomach are...Ch. 26 - _____ 3. Which of the following is an unregulated...Ch. 26 - _____ 4. Which organ (or part of an organ) is...Ch. 26 - _____ 5. Pancreatic juice contains a. HCO3 and...Ch. 26 - _____ 6. Bile is transported through the a....Ch. 26 - _____ 7. Digestion of proteins begins in the a....Ch. 26 - Prob. 8DYBCh. 26 - _____ 9. Digestive enzymes that chemically digest...Ch. 26 - _____ 10. Most of the absorption of our digested...Ch. 26 - The GI tract from the esophagus to the anal canal...Ch. 26 - Discuss the reason why the involuntary sequence of...Ch. 26 - Prob. 13DYBCh. 26 - Compare the structure of the circular folds,...Ch. 26 - Discuss why the tunica mucosa in the colon has a...Ch. 26 - Prob. 16DYBCh. 26 - What is the role of the gallbladder in digestion?Ch. 26 - Describe the different forms of mechanical...Ch. 26 - Prob. 19DYBCh. 26 - How are lipids absorbed in the GI tract?Ch. 26 - Prob. 1CALCh. 26 - Prob. 2CALCh. 26 - What component of the digestive tract can you not...Ch. 26 - The pancreatic ducts are blocked with a thick,...Ch. 26 - Prob. 5CALCh. 26 - Alexandra experienced vomiting and diarrhea and...Ch. 26 - A key event in the chemical digestion processes...Ch. 26 - Most cases of colorectal cancer occur in the most...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License