Loose Leaf For Anatomy & Physiology: An Integrative Approach
Loose Leaf For Anatomy & Physiology: An Integrative Approach
3rd Edition
ISBN: 9781260162493
Author: McKinley Dr., Michael; O'Loughlin, Valerie; Bidle, Theresa
Publisher: McGraw-Hill Education
bartleby

Videos

Question
Book Icon
Chapter 26.1, Problem 11LO
Summary Introduction

To distinguish: Intraperitoneal and retroperitoneal organs.

Concept introduction: The space between the parietal and visceral peritoneum is known as peritoneal cavity which secretes the serous fluid. This fluid provides lubrication to both the external surface of organs and the internal wall of the abdomen. On the basis of the peritoneum covering, the digestive organs are classified as intraperitoneal and retroperitoneal organs.

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 26 Solutions

Loose Leaf For Anatomy & Physiology: An Integrative Approach

Ch. 26.1 - Prob. 5WDLCh. 26.1 - Prob. 7LOCh. 26.1 - Prob. 8LOCh. 26.1 - Prob. 9LOCh. 26.1 - Prob. 6WDLCh. 26.1 - Prob. 7WDLCh. 26.1 - LEARNING OBJECTIVE 10. Describe the structure of...Ch. 26.1 - Prob. 11LOCh. 26.1 - LEARNING OBJECTIVE 12. Explain the function of the...Ch. 26.1 - Prob. 1WDTCh. 26.1 - What is the difference between intraperitoneal and...Ch. 26.1 - Where is the greater omentum located?Ch. 26.2 - Prob. 13LOCh. 26.2 - Prob. 10WDLCh. 26.2 - Prob. 14LOCh. 26.2 - LEARNING OBJECTIVE 15. Describe the structure and...Ch. 26.2 - Prob. 16LOCh. 26.2 - Prob. 17LOCh. 26.2 - Prob. 2WDTCh. 26.2 - Prob. 11WDLCh. 26.2 - Prob. 18LOCh. 26.2 - Prob. 12WDLCh. 26.2 - How is the bolus moved from the oral cavity into...Ch. 26.2 - Prob. 19LOCh. 26.2 - Prob. 20LOCh. 26.2 - Prob. 21LOCh. 26.2 - Prob. 3WDTCh. 26.2 - Prob. 14WDLCh. 26.2 - Prob. 15WDLCh. 26.3 - Prob. 22LOCh. 26.3 - What organs are considered part of the lower GI...Ch. 26.3 - Prob. 23LOCh. 26.3 - Prob. 24LOCh. 26.3 - Prob. 25LOCh. 26.3 - Prob. 4WDTCh. 26.3 - What are the three anatomic structures that...Ch. 26.3 - WHAT DID YOU LEARN? 18 Which type of motility is...Ch. 26.3 - Prob. 26LOCh. 26.3 - Prob. 27LOCh. 26.3 - Prob. 28LOCh. 26.3 - Prob. 5WDTCh. 26.3 - Where do deoxygenated, nutrient-rich blood and...Ch. 26.3 - Prob. 20WDLCh. 26.3 - Prob. 21WDLCh. 26.3 - Prob. 29LOCh. 26.3 - Prob. 30LOCh. 26.3 - Prob. 31LOCh. 26.3 - Prob. 22WDLCh. 26.3 - Prob. 23WDLCh. 26.3 - Which substances are typically absorbed by the...Ch. 26.4 - LEARNING OBJECTIVE 32. Name the three classes of...Ch. 26.4 - Prob. 33LOCh. 26.4 - Prob. 34LOCh. 26.4 - Prob. 25WDLCh. 26.4 - Prob. 35LOCh. 26.4 - Prob. 36LOCh. 26.4 - Prob. 37LOCh. 26.4 - How are proteolytic enzymes activated in the...Ch. 26.4 - LEARNING OBJECTIVE 38. Explain the role of bile...Ch. 26.4 - LEARNING OBJECTIVE 39. Discuss the process by...Ch. 26.4 - What is the function of bile salts in lipid...Ch. 26.4 - WHAT DID YOU LEARN? 28 How do micelles and...Ch. 26.4 - Prob. 40LOCh. 26.4 - Prob. 29WDLCh. 26.4 - Prob. 41LOCh. 26.4 - Prob. 42LOCh. 26.4 - WHAT DID YOU LEARN? 30 Explain the details of...Ch. 26 - _____ 1. Which organ is located in the right upper...Ch. 26 - _____ 2. The _____ cells of the stomach are...Ch. 26 - _____ 3. Which of the following is an unregulated...Ch. 26 - _____ 4. Which organ (or part of an organ) is...Ch. 26 - _____ 5. Pancreatic juice contains a. HCO3 and...Ch. 26 - _____ 6. Bile is transported through the a....Ch. 26 - _____ 7. Digestion of proteins begins in the a....Ch. 26 - Prob. 8DYBCh. 26 - _____ 9. Digestive enzymes that chemically digest...Ch. 26 - _____ 10. Most of the absorption of our digested...Ch. 26 - The GI tract from the esophagus to the anal canal...Ch. 26 - Discuss the reason why the involuntary sequence of...Ch. 26 - Prob. 13DYBCh. 26 - Compare the structure of the circular folds,...Ch. 26 - Discuss why the tunica mucosa in the colon has a...Ch. 26 - Prob. 16DYBCh. 26 - What is the role of the gallbladder in digestion?Ch. 26 - Describe the different forms of mechanical...Ch. 26 - Prob. 19DYBCh. 26 - How are lipids absorbed in the GI tract?Ch. 26 - Prob. 1CALCh. 26 - Prob. 2CALCh. 26 - What component of the digestive tract can you not...Ch. 26 - The pancreatic ducts are blocked with a thick,...Ch. 26 - Prob. 5CALCh. 26 - Alexandra experienced vomiting and diarrhea and...Ch. 26 - A key event in the chemical digestion processes...Ch. 26 - Most cases of colorectal cancer occur in the most...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License