
Nester's Microbiology: A Human Perspective
9th Edition
ISBN: 9781259709999
Author: Denise G. Anderson Lecturer, Sarah Salm, Deborah Allen
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 26, Problem 2A
Summary Introduction
To review:
The reasons for classifying botulism under
Introduction:
Botulism is a rare but potentially fatal disorder caused by the toxins produced by an obligate anaerobe known as Clostridium botulinum. It generates heat resistant endospores, which on germination produce deadly toxins called botulinum toxin that causes pathogenesis.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 26 Solutions
Nester's Microbiology: A Human Perspective
Ch. 26 - Prob. 1SACh. 26 - Prob. 2SACh. 26 - Prob. 3SACh. 26 -
4. Why is listeriosis so important to pregnant...Ch. 26 - Prob. 5SACh. 26 - Give two ways in which viral meningitis usually...Ch. 26 - Prob. 7SACh. 26 - Prob. 8SACh. 26 - Prob. 9SACh. 26 - Prob. 10SA
Ch. 26 - Prob. 1MCCh. 26 - Prob. 2MCCh. 26 - Prob. 3MCCh. 26 - Prob. 4MCCh. 26 - Prob. 5MCCh. 26 -
6. Which of these statements concerning arboviral...Ch. 26 - Prob. 7MCCh. 26 - Prob. 8MCCh. 26 - Prob. 9MCCh. 26 - Which of these statements concerning...Ch. 26 - Prob. 1ACh. 26 - Prob. 2ACh. 26 - Prob. 1CTCh. 26 - Prob. 2CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
12DaysinMarch, Genital Infections for USMLE Step One; Author: Howard Sachs;https://www.youtube.com/watch?v=66zR_FypVFQ;License: Standard youtube license