
Foundations In Microbiology: Basic Principles (10th International Edition)
10th Edition
ISBN: 9781260152425
Author: Kathleen Park Talaro, Barry Chess
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 2.6, Problem 23ELO
23. Describe how an ester bond is formed.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 2 Solutions
Foundations In Microbiology: Basic Principles (10th International Edition)
Ch. 2.1 - Prob. 1ELOCh. 2.1 - Prob. 2ELOCh. 2.1 - Prob. 3ELOCh. 2.1 - Prob. 4ELOCh. 2.1 - Prob. 5ELOCh. 2.1 - Prob. 1CYPCh. 2.1 - Prob. 2CYPCh. 2.1 - Prob. 3CYPCh. 2.1 - Prob. 4CYPCh. 2.1 - Prob. 5CYP
Ch. 2.1 - Prob. 6CYPCh. 2.2 - Prob. 6ELOCh. 2.2 - Prob. 7ELOCh. 2.2 - Prob. 8ELOCh. 2.2 - Prob. 9ELOCh. 2.2 - Prob. 10ELOCh. 2.2 - Prob. 11ELOCh. 2.2 - 7. Explain how the concepti of molecules and...Ch. 2.2 - Prob. 8CYPCh. 2.2 - Prob. 9CYPCh. 2.2 - Prob. 10CYPCh. 2.2 - Prob. 11CYPCh. 2.2 - Prob. 12CYPCh. 2.2 - Prob. 13CYPCh. 2.2 - Prob. 14CYPCh. 2.3 - Prob. 12ELOCh. 2.3 - 13. Explain solutes, solvents, and hydration.Ch. 2.3 - Prob. 14ELOCh. 2.3 - 15. Describe the pH scale and how it was derived;...Ch. 2.3 - Prob. 15CYPCh. 2.3 - Prob. 16CYPCh. 2.3 - 17. What properties of water make it an effective...Ch. 2.3 - Prob. 18CYPCh. 2.3 - 19. What determines whether a substance is an acid...Ch. 2.4 - 16. Describe the chemistry of carbon and the...Ch. 2.4 - Prob. 17ELOCh. 2.4 - Prob. 18ELOCh. 2.4 - Prob. 20CYPCh. 2.4 - Prob. 21CYPCh. 2.4 - Prob. 22CYPCh. 2.4 - 23. What are functional groups?Ch. 2.4 - Prob. 24CYPCh. 2.5 - 19. Define carbohydrate and know the functional...Ch. 2.5 - Prob. 20ELOCh. 2.5 - 21. Discuss the functions of carbohydrates in...Ch. 2.5 - Prob. 25CYPCh. 2.5 - Prob. 26CYPCh. 2.5 - 27. What are some of the functions of...Ch. 2.6 - 22. Define lipid, triglyceride, phospholipid,...Ch. 2.6 - 23. Describe how an ester bond is formed.Ch. 2.6 - Prob. 24ELOCh. 2.6 - 28. Draw simple structural molecules of...Ch. 2.7 - 25. Describe the structures of peptides and...Ch. 2.7 - 26. Characterize the four levels of protein...Ch. 2.7 - 27. Summarize some of the essential functions of...Ch. 2.7 - Prob. 29CYPCh. 2.7 - 30. Differentiate between a peptide, a...Ch. 2.7 - 31. Explain what causes the various levels of...Ch. 2.7 - 32. What functions do proteins perform in a cell?Ch. 2.8 - 28. Identify a nucleic acid and differentiate...Ch. 2.8 - Prob. 29ELOCh. 2.8 - 30. Explain how the DNA code may be copied, and...Ch. 2.8 - 33. Describe a nucleotide and a polynucleotide,...Ch. 2.8 - 34. Name the two purines and the three...Ch. 2.8 - 35. What are the functions of RNA?Ch. 2.8 - 36.What is ATP, and how does it function in cells?Ch. 2.L1 - 1. The smallest unit of matter with unique...Ch. 2.L1 - 2. The charge of a proton is exactly balanced by...Ch. 2.L1 - Prob. 3MCQCh. 2.L1 - Prob. 4MCQCh. 2.L1 - Prob. 5MCQCh. 2.L1 - Prob. 6MCQCh. 2.L1 - Prob. 7MCQCh. 2.L1 - 8. An atom that can donate electrons during a...Ch. 2.L1 - 9. In a solution of NaCl and water, NaCl is the...Ch. 2.L1 - 10. A solution with a pH of 2 than a solution with...Ch. 2.L1 - 11. Fructose is a type of a. disaccharide b....Ch. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L1 - 13. How is our understanding of microbiology...Ch. 2.L1 - 14. A phospholipid contains a. three fatty acids...Ch. 2.L1 - 15. Proteins are synthesized by linking amino...Ch. 2.L1 - 16. The amino acid that accounts for disulfide...Ch. 2.L1 - 17. DNA is a hereditary molecule that is composed...Ch. 2.L1 - 18. What is meant by the term DMA replication? a....Ch. 2.L1 - 19. Proteins can function as a. enzymes b....Ch. 2.L1 - 20. RNA plays an important role in what biological...Ch. 2.L1 - 1. Which of the following has not been a major...Ch. 2.L1 - 2. What was a significant result of the Mars...Ch. 2.L1 - Prob. 3CSRCh. 2.L1 - Prob. 1WCCh. 2.L1 - Prob. 2WCCh. 2.L1 - Prob. 3WCCh. 2.L1 - Prob. 4WCCh. 2.L1 - Prob. 5WCCh. 2.L1 - 6. Why are hydrogen bonds relatively weak?Ch. 2.L1 - 7. What kind of substances will be expected to be...Ch. 2.L1 - Prob. 8WCCh. 2.L1 - Prob. 9WCCh. 2.L1 - 10. What makes the amino acids distinctive, and...Ch. 2.L1 - Prob. 11WCCh. 2.L1 - Prob. 12WCCh. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L2 - Prob. 1CTCh. 2.L2 - Prob. 2CTCh. 2.L2 - Prob. 3CTCh. 2.L2 - 4. Distinguish between polar and ionic compounds.Ch. 2.L2 - 5. Is galactose an aldehyde or a ketone sugar?Ch. 2.L2 - 6. a. How many water molecules are released when a...Ch. 2.L2 - Prob. 7CTCh. 2.L2 - Prob. 8CTCh. 2.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license