Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 25.7, Problem 36ELO
Summary Introduction
To determine:
The pathogenesis, transmission, and epidemiology of prion disease.
Introduction:
Prions cause a number of diseases called transmissible spongiform encephalitis, of which the human diseases are Creutzfeldt-Jakob disease, kuru, Gerstmann-Strussler-Scheinker disease, and fatal familial insomnia.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 25 Solutions
Foundations in Microbiology
Ch. 25.1 - Prob. 1ELOCh. 25.1 - Understand what is meant by antigenic shift and...Ch. 25.1 - Prob. 3ELOCh. 25.1 - Prob. 4ELOCh. 25.1 - Prob. 5ELOCh. 25.1 - Prob. 1CYPCh. 25.1 - What is unusual about the genome of influenza...Ch. 25.1 - Explain how antigenic shift and drift differ and...Ch. 25.1 - Explain the course of infection and disease and...Ch. 25.1 - Explain generally how flu vaccines are prepared....
Ch. 25.1 - Prob. 6CYPCh. 25.1 - Prob. 7CYPCh. 25.2 - Recall the enveloped viruses possessing a...Ch. 25.2 - Prob. 7ELOCh. 25.2 - Prob. 8ELOCh. 25.2 - Prob. 9ELOCh. 25.2 - Describe the structural characteristics common to...Ch. 25.2 - Describe the steps in the production of...Ch. 25.2 - Prob. 10CYPCh. 25.2 - Name two examples of Paramyxovirus and describe...Ch. 25.2 - Prob. 12CYPCh. 25.2 - Summarize the epidemiology, diagnosis, treatment,...Ch. 25.2 - Describe the epidemiological cycle in rabies.Ch. 25.2 - Which animals in the United States are most...Ch. 25.2 - Prob. 16CYPCh. 25.2 - Prob. 17CYPCh. 25.3 - Prob. 10ELOCh. 25.3 - Understand the epidemiology, diagnosis, and...Ch. 25.3 - Prob. 12ELOCh. 25.3 - Summarize the transmission and pathology of the...Ch. 25.3 - Prob. 18CYPCh. 25.3 - Prob. 19CYPCh. 25.3 - Prob. 20CYPCh. 25.3 - Prob. 21CYPCh. 25.3 - Prob. 22CYPCh. 25.3 - Outline a typical course of hepatitis C infection,...Ch. 25.4 - Prob. 14ELOCh. 25.4 - Describe the pathology of arboviral disease.Ch. 25.4 - Prob. 16ELOCh. 25.4 - Name several activities that increase the risk of...Ch. 25.4 - Prob. 25CYPCh. 25.4 - Prob. 26CYPCh. 25.4 - How is the cycle of the viruses maintained in the...Ch. 25.4 - Describe the symptoms of the encephalitis type of...Ch. 25.4 - Prob. 29CYPCh. 25.5 - Prob. 17ELOCh. 25.5 - Prob. 18ELOCh. 25.5 - Describe the structural features of the human...Ch. 25.5 - Prob. 20ELOCh. 25.5 - Prob. 21ELOCh. 25.5 - Prob. 22ELOCh. 25.5 - Prob. 23ELOCh. 25.5 - Prob. 24ELOCh. 25.5 - Prob. 25ELOCh. 25.5 - Understand the purpose of using combination...Ch. 25.5 - Describe the diseases associated with HTLV-I.Ch. 25.5 - What are retroviruses, and how are they different...Ch. 25.5 - Prob. 31CYPCh. 25.5 - Prob. 32CYPCh. 25.5 - Prob. 33CYPCh. 25.5 - Prob. 34CYPCh. 25.5 - Prob. 35CYPCh. 25.5 - Prob. 36CYPCh. 25.5 - Prob. 37CYPCh. 25.5 - Prob. 38CYPCh. 25.5 - List the major opportunistic bacterial, fungal,...Ch. 25.5 - Prob. 40CYPCh. 25.5 - Prob. 41CYPCh. 25.5 - Prob. 42CYPCh. 25.5 - What is the rationale behind the use of HAART...Ch. 25.5 - Prob. 44CYPCh. 25.5 - Prob. 45CYPCh. 25.6 - Prob. 28ELOCh. 25.6 - Describe the range of pathologies seen in...Ch. 25.6 - Prob. 30ELOCh. 25.6 - Understand the epidemiology, diagnosis, and...Ch. 25.6 - Understand why rhinovirus infections are typically...Ch. 25.6 - Describe the epidemiology and pathology of...Ch. 25.6 - Prob. 34ELOCh. 25.6 - Prob. 46CYPCh. 25.6 - Prob. 47CYPCh. 25.6 - Prob. 48CYPCh. 25.6 - Prob. 49CYPCh. 25.6 - What characteristics of enteric viruses cause them...Ch. 25.6 - Prob. 51CYPCh. 25.6 - Prob. 52CYPCh. 25.6 - List several activities that reduce the incidence...Ch. 25.6 - Prob. 54CYPCh. 25.6 - Prob. 55CYPCh. 25.6 - Prob. 56CYPCh. 25.6 - Prob. 57CYPCh. 25.6 - What viruses possess a double-stranded RNA genome...Ch. 25.7 - Prob. 35ELOCh. 25.7 - Prob. 36ELOCh. 25.7 - Prob. 37ELOCh. 25.7 - Describe the characteristics of the agents...Ch. 25.7 - Explain how bovine spongiform encephalopathy can...Ch. 25.7 - Make a flowchart to explain the mechanism of how...Ch. 25.7 - Prob. 62CYPCh. 25.7 - Prob. 63CYPCh. 25.L1 - Which receptors of the influenza virus are...Ch. 25.L1 - Prob. 2MCQCh. 25.L1 - Prob. 3MCQCh. 25.L1 - Prob. 4MCQCh. 25.L1 - Prob. 5MCQCh. 25.L1 - A common, highly diagnostic sign of measles is a....Ch. 25.L1 - Prob. 7MCQCh. 25.L1 - For which disease are active and passive...Ch. 25.L1 - Prob. 9MCQCh. 25.L1 - Prob. 10MCQCh. 25.L1 - Prob. 11MCQCh. 25.L1 - Rhinoviruses are the most common cause of a....Ch. 25.L1 - Prob. 13MCQCh. 25.L1 - Prob. 14MCQCh. 25.L1 - Prob. 15MCQCh. 25.L1 - Prob. 16MCQCh. 25.L1 - Prob. 1CSRCh. 25.L1 - Prob. 2CSRCh. 25.L1 - Prob. 3CSRCh. 25.L1 - Prob. 1WCCh. 25.L1 - Prob. 2WCCh. 25.L1 - Prob. 3WCCh. 25.L1 - Prob. 4WCCh. 25.L1 - Prob. 5WCCh. 25.L1 - Prob. 6WCCh. 25.L2 - a. Explain the relationship between herd immunity...Ch. 25.L2 - Prob. 2CTCh. 25.L2 - Prob. 3CTCh. 25.L2 - Prob. 4CTCh. 25.L2 - Prob. 5CTCh. 25.L2 - Prob. 6CTCh. 25.L2 - Prob. 7CTCh. 25.L2 - Prob. 8CTCh. 25.L2 - Prob. 9CTCh. 25.L2 - Prob. 10CTCh. 25.L2 - Biopsies from the liver and intestine of an...Ch. 25.L2 - Refer to figures 25.2 and 25.23, and compare and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Health Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Epidemiological Studies - made easy!; Author: Let's Learn Public Health;https://www.youtube.com/watch?v=Jd3gFT0-C4s;License: Standard Youtube License