ANATOMY+PHYSIOLOGY F/FD <CUSTOM>
2nd Edition
ISBN: 9781260993738
Author: McKinley
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 25.2, Problem 7WDYL
Summary Introduction
To explain:
The stimuli which activate the thirst center in the human body.
Concept introduction:
The thirst centers are controlled by the centers in the hypothalamus in the brain. These centers control the activation and inhibition of thirst centers in the brain. These regions are activated when the fluid intake is less as compared to the fluid output in the human body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 25 Solutions
ANATOMY+PHYSIOLOGY F/FD <CUSTOM>
Ch. 25.1 - Prob. 1WDYLCh. 25.1 - Which ions are more prevalent in the intracellular...Ch. 25.1 - What is the major distinction in the chemical...Ch. 25.1 - Prob. 4WDYLCh. 25.2 - What are the two major sources of fluid intake?...Ch. 25.2 - How would you distinguish fluid deficiency from...Ch. 25.2 - Prob. 7WDYLCh. 25.2 - Which of these four hormonesangiotensin II,...Ch. 25.3 - Why do electrolytes exert a greater osmotic...Ch. 25.3 - Prob. 10WDYL
Ch. 25.4 - Prob. 11WDYLCh. 25.4 - How does the homeostatic system involving ADH...Ch. 25.4 - How does aldosterone influence the contents and...Ch. 25.4 - Prob. 14WDYLCh. 25.5 - What is meant by acid-base balance?Ch. 25.5 - How are fixed acids distinguished from volatile...Ch. 25.5 - How do the kidneys regulate fixed acids to help...Ch. 25.5 - Prob. 18WDYLCh. 25.5 - What are the three chemical buffering systems, and...Ch. 25.5 - Prob. 20WDYLCh. 25.6 - How does a compensated acid-base imbalance differ...Ch. 25.6 - Prob. 22WDYLCh. 25.6 - What is the primary cause of metabolic alkalosis?Ch. 25.6 - Prob. 24WDYLCh. 25 - Prob. 1DYKBCh. 25 - _____ 2. The fluid compartment with the largest...Ch. 25 - _____3. Which of the following would result in...Ch. 25 - _____4. If an individual has decreased saliva...Ch. 25 - _____5. Which hormone decreases total body fluid,...Ch. 25 - Which of the following describes an electrolyte?...Ch. 25 - Prob. 7DYKBCh. 25 - An increase in blood CO2 levels is followed by...Ch. 25 - Which of the following is not a chemical buffer in...Ch. 25 - The kidney can act to buffer the blood by a....Ch. 25 - List the three variables that determine the...Ch. 25 - Describe the movement of water between the...Ch. 25 - Prob. 13DYKBCh. 25 - Explain the homeostatic system involving the renin...Ch. 25 - Describe how ANP is regulated and how it opposes...Ch. 25 - Describe the functions of Na+ and how it is...Ch. 25 - Describe what occurs in the kidney to maintain...Ch. 25 - Prob. 18DYKBCh. 25 - List the three chemical buffers, and describe how...Ch. 25 - Describe respiratory acidosis and its...Ch. 25 - Maria brings her baby to the emergency room. She...Ch. 25 - Prob. 2CALCh. 25 - Prob. 3CALCh. 25 - Harold has been suffering from diabetes mellitus...Ch. 25 - Prob. 5CALCh. 25 - Morgan is a nurse at the local hospital. She...Ch. 25 - Ms. Taylor, 68 years old, has been vomiting for 2...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College