Anatomy & Physiology
3rd Edition
ISBN: 9781259398629
Author: McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher: Mcgraw Hill Education,
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 2.4, Problem 30LO
Summary Introduction
To explain: The way by which amphipathic molecules interact in water to form chemical barriers.
Concept introduction: Water is an inorganic compound used as a universal solvent. H2O is the chemical formula of water. It is a tasteless and odorless liquid at room temperature. Water is a polar inorganic solvent, which is amphoteric in nature. It means that it can act as a base and acid at the same time.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 2 Solutions
Anatomy & Physiology
Ch. 2.1 - Prob. 1LOCh. 2.1 - Prob. 2LOCh. 2.1 - Prob. 3LOCh. 2.1 - Prob. 4LOCh. 2.1 - Prob. 1WDTCh. 2.1 - What subatomic particles determine the mass of an...Ch. 2.1 - Diagram the atomic structure of chlorineatomic...Ch. 2.1 - Prob. 5LOCh. 2.1 - Prob. 6LOCh. 2.1 - Do isotopes represent the same element? Do they...
Ch. 2.1 - Prob. 7LOCh. 2.1 - Prob. 8LOCh. 2.1 - Prob. 4WDLCh. 2.2 - LEARNING OBJECTIVES
9. Define an ion.
Ch. 2.2 - LEARNING OBJECTIVES
10. List some common ions in...Ch. 2.2 - Prob. 11LOCh. 2.2 - Prob. 12LOCh. 2.2 - Prob. 2WDTCh. 2.2 - List the common cations and anions of the human...Ch. 2.2 - Prob. 6WDLCh. 2.2 - Explain how and why ions form based on the octet...Ch. 2.2 - Prob. 13LOCh. 2.2 - Prob. 14LOCh. 2.2 - Prob. 15LOCh. 2.2 - Could an ionic bond form between two cations or...Ch. 2.3 - LEARNING OBJECTIVES
16. Define a molecular...Ch. 2.3 - Prob. 17LOCh. 2.3 - Prob. 9WDLCh. 2.3 - What is an isomer?Ch. 2.3 - Prob. 18LOCh. 2.3 - Prob. 19LOCh. 2.3 - Prob. 20LOCh. 2.3 - Prob. 21LOCh. 2.3 - Explain covalent bond formation in terms of...Ch. 2.3 - Assign the partial charges between nitrogen and...Ch. 2.3 - Why are some covalent bonds nonpolar and others...Ch. 2.3 - Prob. 22LOCh. 2.3 - Prob. 23LOCh. 2.3 - WHAT DO YOU THINK?
3 Is the fatty acid portion of...Ch. 2.3 - Are O2, and CO2 nonpolar or polar molecules?Ch. 2.3 - Prob. 24LOCh. 2.3 - Prob. 25LOCh. 2.3 - What is the name of the intermolecular attraction...Ch. 2.4 - Prob. 26LOCh. 2.4 - What is the intermolecular bond that is...Ch. 2.4 - Prob. 27LOCh. 2.4 - Which property of water contributes to the need to...Ch. 2.4 - Prob. 28LOCh. 2.4 - Prob. 29LOCh. 2.4 - Prob. 30LOCh. 2.4 - How does the interaction of a nonelectrolyte and...Ch. 2.4 - How do phospholipid molecules interact with water...Ch. 2.5 - Prob. 31LOCh. 2.5 - Explain why water is neutral.Ch. 2.5 - Prob. 32LOCh. 2.5 - Which type of substance releases H+ when added to...Ch. 2.5 - Prob. 33LOCh. 2.5 - Prob. 34LOCh. 2.5 - Prob. 35LOCh. 2.5 - Prob. 4WDTCh. 2.5 - What is the general relationship of [H+] and pH?Ch. 2.5 - Why are buffers important and how do they function...Ch. 2.6 - Prob. 36LOCh. 2.6 - Prob. 37LOCh. 2.6 - Prob. 24WDLCh. 2.6 - Why is blood also considered the other two types...Ch. 2.6 - Prob. 38LOCh. 2.6 - What are four ways solution concentration may be...Ch. 2.7 - Prob. 39LOCh. 2.7 - Prob. 40LOCh. 2.7 - Prob. 41LOCh. 2.7 - Prob. 42LOCh. 2.7 - Prob. 27WDLCh. 2.7 - What functional groups may act as an acid?Ch. 2.7 - Prob. 29WDLCh. 2.7 - Prob. 43LOCh. 2.7 - Prob. 44LOCh. 2.7 - Do lipid molecules typically dissolve in water?...Ch. 2.7 - Which class of lipids forms cell membranes? What...Ch. 2.7 - Prob. 45LOCh. 2.7 - Prob. 46LOCh. 2.7 - Prob. 47LOCh. 2.7 - What is the repeating monomer of glycogen? Where...Ch. 2.7 - For each of the following, indicate if it is a...Ch. 2.7 - LEARNING OBJECTIVES
48. Describe the general...Ch. 2.7 - LEARNING OBJECTIVES
49. Describe the structure of...Ch. 2.7 - Prob. 50LOCh. 2.7 - Prob. 51LOCh. 2.7 - What is the general function of nucleic acids?Ch. 2.7 - What are the structural differences between RNA...Ch. 2.7 - Prob. 52LOCh. 2.7 - Prob. 53LOCh. 2.7 - What are the monomers of proteins and the name of...Ch. 2.8 - Prob. 37WDLCh. 2.8 - Prob. 54LOCh. 2.8 - Prob. 55LOCh. 2.8 - Prob. 56LOCh. 2.8 - Prob. 38WDLCh. 2.8 - Prob. 57LOCh. 2.8 - Prob. 58LOCh. 2.8 - Prob. 59LOCh. 2.8 - Prob. 5WDTCh. 2.8 - What distinguishes the tertiary and quaternary...Ch. 2.8 - What happens to a protein when it denatures? How...Ch. 2 - Prob. 1DYBCh. 2 - _____ 2. Substances that dissolve in water include...Ch. 2 - _____ 3. Temperature stabilization is dependent...Ch. 2 - _____ 4. All of the following are accurate about...Ch. 2 - _____ 5. Blood is a mixture that is more...Ch. 2 - Prob. 6DYBCh. 2 - _____ 7. Glucose is stored as which molecule...Ch. 2 - _____ 8. All of the following are common ions of...Ch. 2 - _____ 9. Intermolecular attractions between polar...Ch. 2 - _____ 10. When a protein permanently unfolds, it...Ch. 2 - List the common ions of the human body by name,...Ch. 2 - Describe a polar bond and a polar molecule.Ch. 2 - Diagram two water molecules and label the polar...Ch. 2 - Compare and contrast what occurs when a substance...Ch. 2 - Define the terms acid, base, PH, and buffers.Ch. 2 - Explain the units for expressing a concentration...Ch. 2 - Do You Know the Basics?
17. List the four...Ch. 2 - Prob. 18DYBCh. 2 - Describe how phospholipid molecules form the...Ch. 2 - Explain protein denaturation, including bow it...Ch. 2 - Which property of water is significant in children...Ch. 2 - Prob. 2CALCh. 2 - Prob. 3CALCh. 2 - The condition of rickets involves bones that have...Ch. 2 - The hormone insulin is a __________ composed of...Ch. 2 - Prob. 1CSLCh. 2 - The lab results from a diabetic patient show a...Ch. 2 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
GCSE Chemistry - Acids and Bases #34; Author: Cognito;https://www.youtube.com/watch?v=vt8fB3MFzLk;License: Standard youtube license