
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24, Problem 2RQ
Summary Introduction
To enlist:
The distinguishing characteristics of each phylum and give an example of a member of each phylum.
Introduction:
There are approximately nine major phyla in kingdom Animalia. The phyla are classified based on their common characteristics and differences among them.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 24 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 24.1 - Can you... list the characteristics that...Ch. 24.2 - Prob. 1CYLCh. 24.2 - describe the different types of body symmetry,...Ch. 24.2 - give examples of animal groups with each type of...Ch. 24.2 - Prob. 4CYLCh. 24.3 - Physicians Assistants Another invertebrate animal...Ch. 24.3 - Prob. 1CYLCh. 24.3 - If you have ever accidentally walked into a spider...Ch. 24.3 - Prob. 1TCCh. 24.3 - list some member organisms in each of these...
Ch. 24.3 - Prob. 2TCCh. 24.3 - Prob. 3CYLCh. 24.3 - Prob. 3TCCh. 24.3 - What advantage does a digestive system with two...Ch. 24.3 - Why does pouring sail on a leech harm it?Ch. 24.3 - Prob. 6TCCh. 24.3 - How might insects wings have contributed to their...Ch. 24 - Insects are the largest group of animals on Earth....Ch. 24 - __________ Animals obtain energy by __________;...Ch. 24 - Prob. 1MCCh. 24 - Prob. 1RQCh. 24 - Prob. 2ACCh. 24 - Bilaterally symmetrical animals have __________...Ch. 24 - Prob. 2MCCh. 24 - Prob. 2RQCh. 24 - Animals that have an anterior and posterior end...Ch. 24 - Prob. 3MCCh. 24 - Briefly describe each of the following...Ch. 24 - Lophotrochozoans and ecdysozoans (molting animals)...Ch. 24 - Prob. 4MCCh. 24 - Prob. 4RQCh. 24 - Prob. 5FIBCh. 24 - Prob. 5MCCh. 24 - Prob. 5RQCh. 24 - Three major groups within the mollusks are the...Ch. 24 - Prob. 6RQCh. 24 - Prob. 7FIBCh. 24 - Prob. 7RQCh. 24 - For each of the following distinctive structures,...Ch. 24 - Prob. 8RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning