Concept explainers
To review:
The success of anticancerousprogramme against hepatitis B.
Introduction:
Hepatitis is an inflammatory problem of the liver, which can be caused by drugs, certain medical conditions, or by use ofalcohol. Hepatitis can be caused by hepatotropic viruses commonly called as hepatitis virus. Most common forms of hepatitis viruses are hepatitisA virus (HAV), B (HBV), C (HCV), D (HDV), and E (HEV). Infection of hepatitis can be occurred by viral hepatitis or nonviral hepatitis(drugs or toxins, and alcoholuse) cause livercirrhosis and hepaticcarcinoma.
Moreover, cancer can be caused by multiple factors such as radiations, defect at the molecularlevel, excess use of alcohol, infection by pathogenic strains (Helicobacter pylori, and Hepatitis B). Hepatitis B has a limited number of vaccines for adults and newborns, which preventhepatitis B and its harmful consequence that includes liver cancer and cirrhosis.

Want to see the full answer?
Check out a sample textbook solution
Chapter 24 Solutions
NESTER'S MICROBIOLOGY
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

