
Concept explainers
Insects are the largest group of animals on Earth. Insect diversity is greatest in the tropics, where habitat destruction and species extinction are occurring at an alarming rate. What biological, economic, and ethical arguments can you advance to persuade people and governments to preserve this biological diversity?

To discuss:
The biological, economic, and ethical aspects regarding the preservation of insects.
Introduction:
The insects are included in the arthropods. The insects have an exoskeleton made up of chitin, three pairs of legs, and a segmented body. The insects are a major part of the ecosystem.
Explanation of Solution
All the living organisms are interdependent for their survival. The richness of plants and animals in a distinct habitat determines the biodiversity of that region. The services offered by nature reduced by the loss of biodiversity.
Biological importance:
One of the efficient methods of pollination is insect-pollination. The insects, such as bees and flies transfer the pollen grains to the other flowers of the same or different plants. This leads to the increase in pollination, thus benefiting the plants. The bees and flies attracted to the flowers for the nectar produced by the flowers. Some of the insects are decomposers and help in maintaining the richness of soil and aerate the soil by digging holes as their homes.
Economic importance:
Some of the insects are highly valuable in terms of products that are obtained from them. The silk, lacquer, wax, and honey is obtained and they are economical to humans.
Ethical importance:
Diseases developed by the microbes transmitted by insects every year affect the humans. The insects should be preserved even if insects are harming humans because every life form is important for the continuation of life on Earth. Any sort of disturbance in levels of life forms will affect all the life forms.
The insects are important in terms of economic, biological, and ethical aspects because the balance of all life forms is necessary for the well functioning of the life cycle of all organisms on this planet.
Want to see more full solutions like this?
Chapter 24 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning




