Concept explainers
Videos
Introduction :
Along with cell wall in plant cell there are many different cells that have specific function and form tissue. There are three types of cells that form the plant tissues. They function together to provide food production and storage; give flexibility, support, and strength to the plants. Parenchyma is the most flexible and thin cell found in the plants. They are responsible for the structure of plants and have many other function like food storage, gas exchange, photosynthesis, and protection. The next cell is collenchyma; they are cylindrical in shape and give support around the cell. They consist of unevenly thickened cell walls. This cell retain the ability to process cell division ones get matured. The third cell is the sclerenchyma; they are lack of cytoplasm and other living components ones get mature. They have thick and rigid cell wall; they involve in providing support to the cell and also help in transportation of materials within the cell.
Answer to Problem 6A
Correct answer :
The correct answer is option (D).
Explanation of Solution
Explanation/justification for the correct answer :
Option (D) the picture given in option D is of trichomes on a leaf. They are hairlike projections found in some of the epidermal cells on leaves. They involve in the protection of plants from animal and insect predators. So, the correct answer is option (D).
Explanation for incorrect answer :
Option (A) the picture indicates in option A is of parenchyma cell without chloroplast. They are responsible for the structure of plants and have many other function like food storage, gas exchange, photosynthesis, and protection. So, this is an incorrect answer
Option (B) the picture given in option B is of root cap that covers the root tips and loses cells as the root grows through soil. So, this is an incorrect option.
Option (C) The picture given in option C is of epidermal cells. The epidermal cell provides protection to the plants from the environment, found in the epidermis of stem, and leaves, and consist of chloroplast. So, this is an incorrect answer.
Chapter 22 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Chemistry: The Central Science (14th Edition)
Organic Chemistry (8th Edition)
Microbiology: An Introduction
Anatomy & Physiology (6th Edition)
Introductory Chemistry (6th Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education