Fundamentals of Anatomy & Physiology, Custom edition for Houston Community College Northwest, Volume 1, Includes student access code card
18th Edition
ISBN: 9781323627983
Author: Martini, Nath, Bartholomew
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 22, Problem 5RQ
Summary Introduction
Introduction:
Major Histocompatibility complex or MHC molecules are a class of cell surface proteins which are encoded by a set of genes. These molecules act as markers and help B-cell and T-cell receptors to recognize the self and foreign molecules and hence are the important component of the immune system.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 22 Solutions
Fundamentals of Anatomy & Physiology, Custom edition for Houston Community College Northwest, Volume 1, Includes student access code card
Ch. 22 - Define pathogen.Ch. 22 - Prob. 2CPCh. 22 - How would blockage of the thoracic duct affect...Ch. 22 - Prob. 4CPCh. 22 - Prob. 5CPCh. 22 - Prob. 6CPCh. 22 - Prob. 7CPCh. 22 - Prob. 8CPCh. 22 - Prob. 9CPCh. 22 - What effects do pyrogens have in the body?
Ch. 22 - Explain the difference between cell-mediated...Ch. 22 - Prob. 12CPCh. 22 - Prob. 13CPCh. 22 - Prob. 14CPCh. 22 - How can the presence of an abnormal peptide in the...Ch. 22 - A decrease in the number of cytotoxic T cells...Ch. 22 - How would a lack of helper T cells affect the...Ch. 22 - Prob. 18CPCh. 22 - Prob. 19CPCh. 22 - Prob. 20CPCh. 22 - Which would be more negatively affectedthe primary...Ch. 22 - Which kind of immunity protects a developing...Ch. 22 - How does increased stress reduce the effectiveness...Ch. 22 - Prob. 24CPCh. 22 - Prob. 25CPCh. 22 - What may account for the increased incidence of...Ch. 22 - Prob. 27CPCh. 22 - Prob. 28CPCh. 22 - LEVEL 1 Reviewing Facts and Terms 1. Identify the...Ch. 22 - Prob. 2RQCh. 22 - Anatomically, lymphatic vessels resemble (a)...Ch. 22 - Prob. 4RQCh. 22 - Prob. 5RQCh. 22 - Prob. 6RQCh. 22 - Phagocytes move through capillary walls by...Ch. 22 - Prob. 8RQCh. 22 - Prob. 9RQCh. 22 - Prob. 10RQCh. 22 - CD4 markers are associated with (a) cytotoxic T...Ch. 22 - Prob. 12RQCh. 22 - Prob. 13RQCh. 22 - What are the three classes of lymphocytes, and...Ch. 22 - What seven defenses present at birth provide the...Ch. 22 - Compared with innate defenses adaptive defenses...Ch. 22 - Prob. 17RQCh. 22 - A decrease in which population of lymphocytes...Ch. 22 - Skin tests are used to determine if a person (a)...Ch. 22 - Compare and contrast the effects of complement...Ch. 22 - How does a cytotoxic T cell destroy another cell...Ch. 22 - How does the formation of an antigen-antibody...Ch. 22 - Give one example of each type of immunity: innate...Ch. 22 - Prob. 24RQCh. 22 - An investigator at a crime scene discovers some...Ch. 22 - Ted finds out that he has been exposed to measles....Ch. 22 - While walking along the street, you and your...Ch. 22 - Paulas grandfather is diagnosed as having lung...Ch. 22 - Willy is allergic to ragweed pollen and tells you...Ch. 22 - Prob. 1CCCh. 22 - Does baby Ruthie still need her chickenpox vaccine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License