Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 21.L1, Problem 16MCQ
Summary Introduction
Introduction:
The dental caries and other problems of teeth surface begin when the teeth have been cleaned. It the perfect landscape for colonization by microbes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 21 Solutions
Foundations in Microbiology
Ch. 21.1 - Differentiate among the different stages of...Ch. 21.1 - Prob. 2ELOCh. 21.1 - List the nonsyphilitic treponematoses.Ch. 21.1 - Prob. 4ELOCh. 21.1 - Identify the vectors and behaviors associated with...Ch. 21.1 - Construct a table comparing the symptoms of...Ch. 21.1 - Prob. 2CYPCh. 21.1 - Besides syphilis, what other diseases are caused...Ch. 21.1 - List several behaviors that would put one at risk...Ch. 21.2 - Relate the physical characteristics seen in the...
Ch. 21.2 - Understand the pathogenesis of cholera.Ch. 21.2 - Name the usual source of infection for each genus...Ch. 21.2 - Prob. 9ELOCh. 21.2 - How could one differentiate the genera Vibrio,...Ch. 21.2 - Prob. 6CYPCh. 21.2 - Which two species of curviform bacteria are...Ch. 21.2 - Briefly describe the nature of food infection in...Ch. 21.2 - Prob. 9CYPCh. 21.3 - Prob. 10ELOCh. 21.3 - Understand the epidemiology and pathology of Rocky...Ch. 21.3 - Prob. 12ELOCh. 21.3 - Prob. 13ELOCh. 21.3 - Prob. 14ELOCh. 21.3 - Recall the names and characteristics of diseases...Ch. 21.3 - What do rickettsias and chlamydias derive from the...Ch. 21.3 - Provide an example of a species, vector, and...Ch. 21.3 - Prob. 12CYPCh. 21.3 - Prob. 13CYPCh. 21.3 - Prob. 14CYPCh. 21.3 - Prob. 15CYPCh. 21.3 - Prob. 16CYPCh. 21.3 - Prob. 17CYPCh. 21.4 - Describe the characteristics and diseases of...Ch. 21.4 - Describe how L forms may arise.Ch. 21.4 - Prob. 18CYPCh. 21.4 - Prob. 19CYPCh. 21.4 - Which body systems are affected by mycoplasma...Ch. 21.4 - Explain why penicillin therapy may result in the...Ch. 21.5 - Discuss the formation of plaque on tooth surfaces.Ch. 21.5 - Relate the formation of plaque to periodontitis.Ch. 21.5 - Prob. 22CYPCh. 21.5 - Prob. 23CYPCh. 21.5 - Prob. 24CYPCh. 21.5 - Prob. 25CYPCh. 21.L1 - Prob. 1MCQCh. 21.L1 - Prob. 2MCQCh. 21.L1 - Prob. 3MCQCh. 21.L1 - Prob. 4MCQCh. 21.L1 - Prob. 5MCQCh. 21.L1 - Prob. 6MCQCh. 21.L1 - Relapsing fever is spread by a. lice b. ticks c....Ch. 21.L1 - Prob. 8MCQCh. 21.L1 - Prob. 9MCQCh. 21.L1 - Prob. 10MCQCh. 21.L1 - Prob. 11MCQCh. 21.L1 - Prob. 12MCQCh. 21.L1 - Prob. 13MCQCh. 21.L1 - Prob. 14MCQCh. 21.L1 - Mycoplasmas attack the ____ of host cells. a....Ch. 21.L1 - Prob. 16MCQCh. 21.L1 - Prob. 17MCQCh. 21.L1 - Prob. 18MCQCh. 21.L1 - Prob. 19MCQCh. 21.L1 - Prob. 20MCQCh. 21.L1 - Prob. 1CSRCh. 21.L1 - What other risk factors could have alerted...Ch. 21.L1 - Prob. 3CSRCh. 21.L1 - Prob. 1WCCh. 21.L1 - Prob. 2WCCh. 21.L1 - a. In what ways are dental diseases mixed...Ch. 21.L1 - a. Which diseases in this chapter are zoonoses? b....Ch. 21.L2 - a. Why does syphilis have such profound effects on...Ch. 21.L2 - a. In view of the fact that cholera causes the...Ch. 21.L2 - Prob. 3CTCh. 21.L2 - Prob. 4CTCh. 21.L2 - Prob. 5CTCh. 21.L2 - Prob. 6CTCh. 21.L2 - Prob. 7CTCh. 21.L2 - Which two infectious agents covered in this...Ch. 21.L2 - a. In what way is the oral cavity an ecological...Ch. 21.L2 - Prob. 10CTCh. 21.L2 - Prob. 11CTCh. 21.L2 - Prob. 12CTCh. 21.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Complications during Labour and Delivery; Author: FirstCry Parenting;https://www.youtube.com/watch?v=QnCviG4GpYg;License: Standard YouTube License, CC-BY