Foundations in Microbiology
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
bartleby

Videos

Question
Book Icon
Chapter 21.5, Problem 22CYP
Summary Introduction

Introduction:

The dietary carbohydrates help in plaque formation and the fermentation of these dietary carbohydrate help the plaque mature. These then readily trap food and develop into dental caries.

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 21 Solutions

Foundations in Microbiology

Ch. 21.2 - Understand the pathogenesis of cholera.Ch. 21.2 - Name the usual source of infection for each genus...Ch. 21.2 - Prob. 9ELOCh. 21.2 - How could one differentiate the genera Vibrio,...Ch. 21.2 - Prob. 6CYPCh. 21.2 - Which two species of curviform bacteria are...Ch. 21.2 - Briefly describe the nature of food infection in...Ch. 21.2 - Prob. 9CYPCh. 21.3 - Prob. 10ELOCh. 21.3 - Understand the epidemiology and pathology of Rocky...Ch. 21.3 - Prob. 12ELOCh. 21.3 - Prob. 13ELOCh. 21.3 - Prob. 14ELOCh. 21.3 - Recall the names and characteristics of diseases...Ch. 21.3 - What do rickettsias and chlamydias derive from the...Ch. 21.3 - Provide an example of a species, vector, and...Ch. 21.3 - Prob. 12CYPCh. 21.3 - Prob. 13CYPCh. 21.3 - Prob. 14CYPCh. 21.3 - Prob. 15CYPCh. 21.3 - Prob. 16CYPCh. 21.3 - Prob. 17CYPCh. 21.4 - Describe the characteristics and diseases of...Ch. 21.4 - Describe how L forms may arise.Ch. 21.4 - Prob. 18CYPCh. 21.4 - Prob. 19CYPCh. 21.4 - Which body systems are affected by mycoplasma...Ch. 21.4 - Explain why penicillin therapy may result in the...Ch. 21.5 - Discuss the formation of plaque on tooth surfaces.Ch. 21.5 - Relate the formation of plaque to periodontitis.Ch. 21.5 - Prob. 22CYPCh. 21.5 - Prob. 23CYPCh. 21.5 - Prob. 24CYPCh. 21.5 - Prob. 25CYPCh. 21.L1 - Prob. 1MCQCh. 21.L1 - Prob. 2MCQCh. 21.L1 - Prob. 3MCQCh. 21.L1 - Prob. 4MCQCh. 21.L1 - Prob. 5MCQCh. 21.L1 - Prob. 6MCQCh. 21.L1 - Relapsing fever is spread by a. lice b. ticks c....Ch. 21.L1 - Prob. 8MCQCh. 21.L1 - Prob. 9MCQCh. 21.L1 - Prob. 10MCQCh. 21.L1 - Prob. 11MCQCh. 21.L1 - Prob. 12MCQCh. 21.L1 - Prob. 13MCQCh. 21.L1 - Prob. 14MCQCh. 21.L1 - Mycoplasmas attack the ____ of host cells. a....Ch. 21.L1 - Prob. 16MCQCh. 21.L1 - Prob. 17MCQCh. 21.L1 - Prob. 18MCQCh. 21.L1 - Prob. 19MCQCh. 21.L1 - Prob. 20MCQCh. 21.L1 - Prob. 1CSRCh. 21.L1 - What other risk factors could have alerted...Ch. 21.L1 - Prob. 3CSRCh. 21.L1 - Prob. 1WCCh. 21.L1 - Prob. 2WCCh. 21.L1 - a. In what ways are dental diseases mixed...Ch. 21.L1 - a. Which diseases in this chapter are zoonoses? b....Ch. 21.L2 - a. Why does syphilis have such profound effects on...Ch. 21.L2 - a. In view of the fact that cholera causes the...Ch. 21.L2 - Prob. 3CTCh. 21.L2 - Prob. 4CTCh. 21.L2 - Prob. 5CTCh. 21.L2 - Prob. 6CTCh. 21.L2 - Prob. 7CTCh. 21.L2 - Which two infectious agents covered in this...Ch. 21.L2 - a. In what way is the oral cavity an ecological...Ch. 21.L2 - Prob. 10CTCh. 21.L2 - Prob. 11CTCh. 21.L2 - Prob. 12CTCh. 21.L2 - Prob. 1VC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Text book image
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Text book image
Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,
Text book image
Body Structures & Functions
Biology
ISBN:9781285695495
Author:Scott
Publisher:Cengage
Text book image
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Infectious Diseases - How do we control them?; Author: Let's Learn Public Health;https://www.youtube.com/watch?v=2JWku3Kjpq0;License: Standard Youtube License