The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Question

Want to see the full answer?

Answer 1

Question

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Answer 6

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Answer 7

Chapter 21, Problem 15RQ

Summary Introduction

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 21 - Prob. 1CP Ch. 21 - Prob. 2CP Ch. 21 - Why are valves located in veins but not in...Ch. 21 - Where in the body would you find fenestrated...Ch. 21 - Prob. 5CP Ch. 21 - In a healthy person, where is blood pressure...Ch. 21 - Prob. 7CP Ch. 21 - Prob. 8CP Ch. 21 - Describe the actions of vasodilators and local...Ch. 21 - Prob. 10CP

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Solution Summary: The author explains that the internal jugular vein drains the dural sinuses of the brain.

Concept explainers

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Want to see the full answer?

Chapter 21 Solutions

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Solution Summary: The author explains that the internal jugular vein drains the dural sinuses of the brain.

Concept explainers

Introduction: The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.

Want to see the full answer?

Chapter 21 Solutions

Introduction:

The dural sinus is located in the cranium and is composed of the dura matter. They are drained by the internal jugular vein.