FUNDAMENTALS OF ANATOMY AND PHYSIOLOGY
11th Edition
ISBN: 2818440070938
Author: Martini
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Question
Chapter 21, Problem 10CP
Summary Introduction
To determine:
The affect on heart rate by the application of slight pressure on the common carotid artery and its affect.
Introduction:
The application of slight pressure on the carotid artery will be sensed by the baroreceptor reflex in carotid arteries of the heart. This decreases the blood pressure, which is sensed by the reflex by the receptors in heart, which regulate the expansion and contraction of the muscles leading to an increase in the heart rate. The sympathetic activity is stimulated and the parasympathetic activity is inhibited.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 21 Solutions
FUNDAMENTALS OF ANATOMY AND PHYSIOLOGY
Ch. 21 - Prob. 1CPCh. 21 - Prob. 2CPCh. 21 - Why are valves located in veins but not in...Ch. 21 - Where in the body would you find fenestrated...Ch. 21 - Prob. 5CPCh. 21 - In a healthy person, where is blood pressure...Ch. 21 - Prob. 7CPCh. 21 - Prob. 8CPCh. 21 - Describe the actions of vasodilators and local...Ch. 21 - Prob. 10CP
Ch. 21 - Prob. 11CPCh. 21 - Why does blood pressure increase during exercise?Ch. 21 - Prob. 13CPCh. 21 - Prob. 14CPCh. 21 - Prob. 15CPCh. 21 - Identify the major patterns of blood vessel...Ch. 21 - Prob. 17CPCh. 21 - Prob. 18CPCh. 21 - Prob. 19CPCh. 21 - Prob. 20CPCh. 21 - Isabella is in an automobile accident and her...Ch. 21 - Prob. 22CPCh. 21 - Prob. 23CPCh. 21 - Name the three vessels that carry blood to and...Ch. 21 - A blood sample taken from an umbilical cord...Ch. 21 - Prob. 26CPCh. 21 - Prob. 27CPCh. 21 - Prob. 28CPCh. 21 - Prob. 29CPCh. 21 - Prob. 30CPCh. 21 - Prob. 31CPCh. 21 - Prob. 1RQCh. 21 - The blood vessels that play the most important...Ch. 21 - Prob. 3RQCh. 21 - Prob. 4RQCh. 21 - Prob. 5RQCh. 21 - Prob. 6RQCh. 21 - Prob. 7RQCh. 21 - Prob. 8RQCh. 21 - Prob. 9RQCh. 21 - Prob. 10RQCh. 21 - Prob. 11RQCh. 21 - Prob. 12RQCh. 21 - Prob. 13RQCh. 21 - Prob. 14RQCh. 21 - Prob. 15RQCh. 21 - Prob. 16RQCh. 21 - What are the primary forces that cause fluid to...Ch. 21 - Prob. 18RQCh. 21 - A major difference between the arterial and venous...Ch. 21 - Which of the following conditions would have the...Ch. 21 - Which of the following is greater? (a) the osmotic...Ch. 21 - Prob. 22RQCh. 21 - Why do capillaries pennit the diffusion of...Ch. 21 - Prob. 24RQCh. 21 - Prob. 25RQCh. 21 - Prob. 26RQCh. 21 - Compare the effects of the cardioacceleratory and...Ch. 21 - Bob is sitting outside on a warm day and is...Ch. 21 - People with allergies commonly take antihistamines...Ch. 21 - Jolene awakens suddenly to the sound of her alarm...Ch. 21 - Prob. 1CCCh. 21 - Prob. 2CC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Respiratory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=v_j-LD2YEqg;License: Standard youtube license