
ANATOMY+PHYS.LAB.MANUAL,MAIN VERSION
4th Edition
ISBN: 9781264265442
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.6, Problem 25WDYL
Summary Introduction
To determine:
How angiotensinogen activated to become angiotensin II and also determine how angiotensin II influence blood pressure.
Concept introduction:
Blood pressure is the pressure on the walls of blood vessels exerted by the blood. The factors that affect blood pressure are: vasoconstriction, hypertension, and so on. The release of miner corticoid hormone from the adrenal cortex regulates the balance of sodium ion and water in kidney and help in maintaining the blood volume and pressure.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 20 Solutions
ANATOMY+PHYS.LAB.MANUAL,MAIN VERSION
Ch. 20.1 - What are three differences in anatomic structure...Ch. 20.1 - Prob. 2WDYLCh. 20.1 - What type of capillary is the most permeable, and...Ch. 20.1 - Prob. 4WDYLCh. 20.1 - Prob. 5WDYLCh. 20.2 - In which type of vessel is blood flow the slowest?...Ch. 20.3 - What substances are transported by diffusion...Ch. 20.3 - Prob. 8WDYLCh. 20.3 - How does the hydrostatic pressure change from the...Ch. 20.3 - Which two pressures have the largest values?...
Ch. 20.3 - If these lymph vessels were nonfunctional, what...Ch. 20.4 - In what ways is angiogenesis stimulated in...Ch. 20.4 - Prob. 13WDYLCh. 20.4 - What relationship exists between metabolic...Ch. 20.4 - Prob. 15WDYLCh. 20.5 - Prob. 16WDYLCh. 20.5 - Prob. 17WDYLCh. 20.5 - How is the small pressure gradient in veins...Ch. 20.5 - How is the pressure gradient to move blood through...Ch. 20.5 - How is resistance defined?Ch. 20.5 - What are the three factors that alter resistance?...Ch. 20.5 - Prob. 22WDYLCh. 20.6 - Prob. 23WDYLCh. 20.6 - What is the initial change to blood pressure when...Ch. 20.6 - Prob. 25WDYLCh. 20.6 - Prob. 26WDYLCh. 20.7 - Which organs have an increased proportion of...Ch. 20.8 - Prob. 28WDYLCh. 20.8 - Prob. 29WDYLCh. 20.9 - Prob. 30WDYLCh. 20.9 - Prob. 31WDYLCh. 20.10 - Prob. 32WDYLCh. 20.10 - Prob. 33WDYLCh. 20.10 - Prob. 34WDYLCh. 20.10 - What are the systemic arteries that supply...Ch. 20.10 - Prob. 36WDYLCh. 20.10 - Prob. 37WDYLCh. 20.10 - Prob. 38WDYLCh. 20.11 - Prob. 39WDYLCh. 20.11 - Prob. 40WDYLCh. 20.11 - Prob. 41WDYLCh. 20.11 - Prob. 42WDYLCh. 20.12 - List the five structures of fetal circulation, and...Ch. 20.12 - Prob. 44WDYLCh. 20 - _____ 1. Which of the following is not a...Ch. 20 - _____ 2. Which statement is accurate about veins?...Ch. 20 - _____ 3. Vasa vasorum are found in the tunica...Ch. 20 - _____ 4. Which of the following decreases...Ch. 20 - _____ 5. The __________ is a type of vessel with...Ch. 20 - _____ 6. An increase in _____ will result in an...Ch. 20 - Prob. 7DYKBCh. 20 - _____ 8. Velocity of blood flow is the slowest in...Ch. 20 - _____ 9. Blood pressure is regulated by the a....Ch. 20 - _____ 10. Name the correct pathway that blood...Ch. 20 - Prob. 11DYKBCh. 20 - Prob. 12DYKBCh. 20 - Explain the difference between hydrostatic and...Ch. 20 - Write the formula for determining net filtration...Ch. 20 - Prob. 15DYKBCh. 20 - Prob. 16DYKBCh. 20 - Briefly explain how changes in cardiac output,...Ch. 20 - Compare how the cardiac center and vasomotor...Ch. 20 - Prob. 19DYKBCh. 20 - What postnatal changes occur in the heart and...Ch. 20 - If a patient has cirrhosis of the liver and is...Ch. 20 - Prob. 2CALCh. 20 - Prob. 3CALCh. 20 - Prob. 4CALCh. 20 - Prob. 5CALCh. 20 - Prob. 1CSLCh. 20 - Arteries tend to have a lot of vascular...Ch. 20 - Explain why an overweight individual with high...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College