
Connect with LearnSmart Labs Access Card for Seeley's A&P
11th Edition
ISBN: 9781259807657
Author: Cinnamon VanPutte, Jennifer Regan, Andrew F. Russo Dr., Rod R. Seeley Dr.
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.3, Problem 12AYP
Summary Introduction
To describe:
The openings of the right and left ventricles and the structure separating the ventricles from each other.
Introduction:
The ventricles are considered to be thick-walled, with the position at the anterior and inferior portion of the heart. The ventricles perform pulmonary circulation and systemic circulation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 20 Solutions
Connect with LearnSmart Labs Access Card for Seeley's A&P
Ch. 20.1 - State the four functions of the heart.Ch. 20.2 - What is the approximate size and shape of the...Ch. 20.2 - Where is the heart located? How does this...Ch. 20.3 - Describe the parts of the pericardium and their...Ch. 20.3 - Describe the three layers of the heart wall, and...Ch. 20.3 - Name the chambers of the heart, and describe their...Ch. 20.3 - List the major blood vessels that enter and leave...Ch. 20.3 - Prob. 8AYPCh. 20.3 - Prob. 9AYPCh. 20.3 - Prob. 10AYP
Ch. 20.3 - Describe the openings of the right and left atria....Ch. 20.3 - Prob. 12AYPCh. 20.3 - Prob. 13AYPCh. 20.3 - Prob. 14AYPCh. 20.4 - Prob. 15AYPCh. 20.5 - Prob. 16AYPCh. 20.5 - Prob. 17AYPCh. 20.5 - Prob. 18AYPCh. 20.5 - Prob. 19AYPCh. 20.5 - Identify the parts of the conducting system of...Ch. 20.5 - Prob. 21AYPCh. 20.5 - Prob. 22AYPCh. 20.6 - Prob. 23AYPCh. 20.6 - Prob. 24AYPCh. 20.6 - Prob. 25AYPCh. 20.6 - Prob. 26AYPCh. 20.6 - What does an ECG measure? Nome the waves...Ch. 20.7 - Define systole and diastole.Ch. 20.7 - List the five periods of the cardiac cycle (see...Ch. 20.7 - Define isovolumetric. When does most ventricular...Ch. 20.7 - Prob. 31AYPCh. 20.7 - Prob. 32AYPCh. 20.7 - Prob. 33AYPCh. 20.8 - Prob. 34AYPCh. 20.8 - Explain the role of MAP in causing blood flow.Ch. 20.8 - Prob. 36AYPCh. 20.8 - Prob. 37AYPCh. 20.9 - Prob. 38AYPCh. 20.9 - Prob. 39AYPCh. 20.9 - Prob. 40AYPCh. 20.9 - Prob. 41AYPCh. 20.9 - Prob. 42AYPCh. 20.9 - Prob. 43AYPCh. 20.10 - Prob. 44AYPCh. 20.10 - Prob. 45AYPCh. 20.10 - What effect does an increase or a decrease...Ch. 20.10 - Prob. 47AYPCh. 20.11 - Prob. 48AYPCh. 20.11 - Prob. 49AYPCh. 20.11 - Prob. 50AYPCh. 20.11 - Prob. 51AYPCh. 20 - Which of these structures returns blood to the...Ch. 20 - Prob. 2RACCh. 20 - Prob. 3RACCh. 20 - Prob. 4RACCh. 20 - Prob. 5RACCh. 20 - Prob. 6RACCh. 20 - Action potentials pass from one cardiac muscle...Ch. 20 - During the transmission of action potentials...Ch. 20 - Given these structures of the conducting system of...Ch. 20 - Prob. 10RACCh. 20 - Prob. 11RACCh. 20 - The greatest amount of ventricular filling occurs...Ch. 20 - Prob. 13RACCh. 20 - Prob. 14RACCh. 20 - Prob. 15RACCh. 20 - Cardiac output is defined as blood pressure times...Ch. 20 - Pressure in the aorta is at its lowest a. at the...Ch. 20 - Prob. 18RACCh. 20 - Prob. 19RACCh. 20 - Prob. 20RACCh. 20 - Prob. 21RACCh. 20 - Increased parasympathetic stimulation of the heart...Ch. 20 - Prob. 23RACCh. 20 - Prob. 24RACCh. 20 - Prob. 25RACCh. 20 - Prob. 1CTCh. 20 - In most tissues, peak blood flow occurs during...Ch. 20 - Prob. 3CTCh. 20 - Prob. 4CTCh. 20 - A patient has tachycardia. Would you recommended a...Ch. 20 - Prob. 6CTCh. 20 - A doctor lets you listen to a patient's heart with...Ch. 20 - Explain why it is sufficient to replace the...Ch. 20 - Prob. 9CTCh. 20 - Prob. 10CTCh. 20 - Prob. 11CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage