Human Biology (MindTap Course List)
11th Edition
ISBN: 9781305112100
Author: Cecie Starr, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 8SQ
Genetic disorders can be caused by __________.
- a. gene mutations
- b. changes in chromosome structure
- c. changes in chromosome number
- d. all of the above
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Tumors involve a malfunction in this cellular process. a. transcription b. translation c. phagocytosis d. mitosis
Stargardt's disease was one of these that can be treated using embryonic stem cells. Why would scientist chose to use this type of stem cell in treatment of Stargard's?
A. There ae not ethical issue concerning their use
B. They retain stem cell properties even after specialization
C. They are able to differentiate into the required cell type
D. They are already specialized for this funtion
Which of the following are characteristics of aging cells (select all that apply)?
A.
Chronic inflammation results in premature shortening of telomeres
B.
Lengthening of telomeric DNA sequence
C.
Accumulation of telomere-dysfunction–induced foci (TIFs)
D.
Older cells produce more telomerase
E.
Increased erosion of telomeres
Chapter 20 Solutions
Human Biology (MindTap Course List)
Ch. 20 - Prob. 1RQCh. 20 - What is a carrier of a genetic trait?Ch. 20 - What evidence indicates that a trait is coded by a...Ch. 20 - Prob. 4RQCh. 20 - Explain what nondisjunction is, and give two...Ch. 20 - _______ segregate during ______. a. Homologues;...Ch. 20 - Prob. 2SQCh. 20 - Genes on the same chromosome tend to stay together...Ch. 20 - Prob. 4SQCh. 20 - A chromosomes structure can be altered by _______....
Ch. 20 - Nondisjunction can be caused by ________. a....Ch. 20 - A gamete affected by nondisjunction could have...Ch. 20 - Genetic disorders can be caused by __________. a....Ch. 20 - A person who is a carrier for a genetic trait...Ch. 20 - Prob. 10SQCh. 20 - If a couple has six boys, what is the probability...Ch. 20 - Human sex chromosomes are XX for females and XY...Ch. 20 - People with Down syndrome have an extra copy of...Ch. 20 - Prob. 4CTCh. 20 - Prob. 5CTCh. 20 - About 4 percent of people of Northern European...Ch. 20 - The following pedigree shows the pattern of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 8. ____________________ is the reciprocal exchange of DNA between two non-sister chromatids, which resultsin the rearrangement of linked alleles.arrow_forwardA.) DNA encodes for the cell genome and is therefore a permanent copy to have a functioning cell. B.)Different changes to the structure of messenger RNA can cause mutations and genomic instability which could lead to abnormal cells in the body. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrectarrow_forwardA stem cell_______________ . a. forms from a progenitor cell b. self-renews c. is differentiated d. gives rise only to fully differentiated daughter cellsarrow_forward
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardThis is a chromosomal disorder resulting from the non-disjunction of chromosome 21 during anaphase that gives an extra copy of the chromosome to the person who has inherited it.arrow_forwardBy definition, a pericentric inversion includes the ________. a. centromere b. chiasma c. telomere d. synapsearrow_forward
- A single gene disorder that produces several symptoms is________.arrow_forwardEdwards Syndrome is a genetic condition in which a person has three copies of chromosome 18. This condition is most likely the result of what process?arrow_forwardMost forms of cancer are caused by environmental agents that produce mutations in somatic cells. Is an individual with cancer considered a genetic mosaic? Explain why or why not.arrow_forward
- Part Carrow_forwardIn the cancer gene detection lab, a restriction enzyme is added to the p53 genes taken from different locations in the person's body; this restriction enzyme cuts at the location of the mutation (if there is one present). When the enzyme is added to the p53 genes from the tumor, this will result in ____ fragments, and _____ bands on an electrophoresis gel when the DNA fragments separate out.arrow_forward18) MUTATIONS: A. Explain the difference between a point mutation and a frameshift mutation. B. Explain how the mutation (both a point mutation and frameshift mutation) might impact the production of proteins. C. Name one type of chromosome mutation and explain what it is.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY